Order Kazusa clone(s) from : ![]() |
Product ID | ORK04421 |
---|---|
Accession No | AB032947 |
Description | Ca++-dependent secretion activator, transcript variant 1 |
Clone name | hh10147 |
Vector information | |
cDNA sequence | DNA sequence (5471 bp) Predicted protein sequence (1390 aa) |
HaloTag ORF Clone |
FHC04421
![]() |
Flexi ORF Clone | FXC04421 |
Source | Human adult brain |
Rouge ID |
mKIAA1121
by Kazusa Mouse cDNA Project
|
Note | We replaced hj00332, former representative clones for KIAA1121 with hh10147. (2001/5/29) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 1059 bp |
---|---|
Genome contig ID | gi89161205r_62259062 |
PolyA signal sequence (AATAAA,-28) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | r | 62359062 | 62836094 | 29 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000008 | 437 | 518 | PF00168 | C2 calcium-dependent membrane targeting |
IPR001849 | 559 | 661 | PF00169 | Pleckstrin-like | |
IPR010439 | 872 | 977 | PF06292 | Protein of unknown function DUF1041 | |
HMMSmart | IPR001849 | 559 | 663 | SM00233 | Pleckstrin-like |
ProfileScan | IPR001849 | 558 | 661 | PS50003 | Pleckstrin-like |
IPR014770 | 968 | 1148 | PS51258 | Munc13 homology 1 |
![]() |
Primer_f | AAAAATGAACCCCTTGTGTCG |
---|---|
Primer_r | ACACAGTTGAGACGTAAAAGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AAAAATGAACCCCTTGTGTCG |
Primer_r | ACACAGTTGAGACGTAAAAGC |
PCR product length | 224 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |