Order Kazusa clone(s) from : ![]() |
Product ID | ORK05410 |
---|---|
Accession No | AB032957 |
Description | HECT domain containing E3 ubiquitin protein ligase 1 |
Clone name | pf08614 |
Vector information | |
cDNA sequence | DNA sequence (7320 bp) Predicted protein sequence (2168 aa) |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1131
by Kazusa Mouse cDNA Project
|
Note | We replaced hh01054, former representative clones for KIAA1131 with pf08614. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 812 bp |
---|---|
Genome contig ID | gi51511730r_30539075 |
PolyA signal sequence (ATTAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | r | 30639075 | 30708431 | 35 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002110 | 18 | 30 | PR01415 | Ankyrin |
IPR002110 | 30 | 42 | PR01415 | Ankyrin | |
HMMPfam | IPR002110 | 1 | 16 | PF00023 | Ankyrin |
IPR002110 | 17 | 52 | PF00023 | Ankyrin | |
IPR012919 | 665 | 798 | PF07738 | Sad1/UNC-like | |
IPR010606 | 835 | 896 | PF06701 | Mib_herc2 | |
IPR000569 | 1737 | 2168 | PF00632 | HECT | |
HMMSmart | IPR000569 | 1701 | 2168 | SM00119 | HECT |
ProfileScan | IPR002110 | 1 | 41 | PS50297 | Ankyrin |
IPR000569 | 1709 | 2168 | PS50237 | HECT |
![]() |
Primer_f | GCCTCAAGAGCAATAGTATGG |
---|---|
Primer_r | ATTCTCAGCCCATTCCATCAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTTTTTAATGATGGCCTGCAC |
Primer_r | GCACTTAGACCAGGTTTTCCC |
PCR product length | 204 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |