KIAA1320

Product ID	ORK05390
Accession No	AB037741
Description	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1
Clone name	fh13757
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5321 bp) Predicted protein sequence (567 aa)
Source	Human fetal brain
Rouge ID	mKIAA1320 by Kazusa Mouse cDNA Project

Length: 5321 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1567 bp
Genome contig ID	gi89161210r_105182663
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GTAAAAGAGATAGATAATAAAATATTAAATAACTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTGTGGTGGCTTATGTCTGTAATCTCAGCATTTCGAGAGGCTGAGGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	105282663	105341982	13	99.5	Perfect prediction

Length: 567 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAH71889	100.0	HECT domain and...	Homo sapiens
CAH71890	99.8	HECT domain and...	Homo sapiens
Q8IYU2	99.8	E3 ubiquitin-pr...	Homo sapiens
BAE00393	99.5	unnamed protein...	Macaca fascicularis
XP_001142834	99.6	HECT domain and...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002310	4.5e-55	37.2	KIAA0312
AB007899	6.5e-54	42.6	KIAA0439
D42055	3.3e-52	41.3	KIAA0093
AB046845	2.2e-50	42.2	KIAA1625
AB002320	4e-49	41.7	KIAA0322

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000569	260	567	PF00632	HECT
HMMSmart	IPR000569	230	567	SM00119	HECT
ProfileScan	IPR000569	232	567	PS50237	HECT

Primer_f	CTGTGCCATATACTCCAAATC
Primer_r	ATTGTGCATCAGTAGTCAGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-