Gene/Protein Characteristic Table for KIAA1141
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00185
Accession No AB032967
Description zinc finger protein 473, transcript variant 1
Clone name hk01833
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4566 bp)
Predicted protein sequence (914 aa)
Flexi ORF Clone FXC00185
Source Human adult brain
Rouge ID mKIAA1141 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4566 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 1713 bp
Genome contig ID gi42406306f_55121024
PolyA signal sequence
(ATTAAA,-17)		 
+----*----+----*----+----*----+----
ATATTTGTTGGTTCTCTGATTAAAGTTTTGAGTCT
Flanking genome sequence
(122819 - 122868)		 
----+----*----+----*----+----*----+----*----+----*
AAAAGCATTGGTTCCTTCTCTCAGCCTGCTGCCATGCAGCCACGCATCAG

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 19 f 55221024 55243841 5 99.1 Perfect prediction
Features of the protein sequence
Description

Length: 914 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10427 0 100.0 zinc finger pro...
 synthetic construct
Q8WTR7 0 99.9 Zinc finger pro...
 Homo sapiens
CAH56173 0 99.7 hypothetical pr...
 Homo sapiens
BAG63633 0 99.8 unnamed protein...
 Homo sapiens
XP_524350 0 98.3 zinc finger pro...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB075842 7.9e-54 40.7 KIAA1962
AB058755 2.9e-52 34.2 KIAA1852
D31763 3.5e-51 40.8 KIAA0065
AB037770 3.8e-50 40.6 KIAA1349
AB046831 1.2e-49 47.0 KIAA1611
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 363 386 PD000003 Zinc finger
IPR007087 446 469 PD000003 Zinc finger
IPR007087 474 497 PD000003 Zinc finger
IPR007087 502 525 PD000003 Zinc finger
IPR007087 634 657 PD000003 Zinc finger
IPR007087 689 711 PD000003 Zinc finger
IPR007087 717 739 PD000003 Zinc finger
IPR007087 747 768 PD000003 Zinc finger
IPR007087 773 796 PD000003 Zinc finger
IPR007087 801 824 PD000003 Zinc finger
IPR007087 829 852 PD000003 Zinc finger
IPR007087 857 880 PD000003 Zinc finger
IPR007087 885 907 PD000003 Zinc finger
HMMPfam IPR001909 49 89 PF01352 KRAB box
IPR007087 252 274 PF00096 Zinc finger
IPR007087 363 385 PF00096 Zinc finger
IPR007087 390 412 PF00096 Zinc finger
IPR007087 418 440 PF00096 Zinc finger
IPR007087 446 468 PF00096 Zinc finger
IPR007087 474 496 PF00096 Zinc finger
IPR007087 502 524 PF00096 Zinc finger
IPR007087 530 552 PF00096 Zinc finger
IPR007087 605 627 PF00096 Zinc finger
IPR007087 634 656 PF00096 Zinc finger
IPR007087 689 711 PF00096 Zinc finger
IPR007087 717 739 PF00096 Zinc finger
IPR007087 745 767 PF00096 Zinc finger
IPR007087 773 795 PF00096 Zinc finger
IPR007087 801 823 PF00096 Zinc finger
IPR007087 829 851 PF00096 Zinc finger
IPR007087 857 879 PF00096 Zinc finger
IPR007087 885 907 PF00096 Zinc finger
HMMSmart IPR001909 49 107 SM00349 KRAB box
IPR015880 252 274 SM00355 Zinc finger
IPR015880 308 329 SM00355 Zinc finger
IPR015880 363 385 SM00355 Zinc finger
IPR015880 390 412 SM00355 Zinc finger
IPR015880 418 440 SM00355 Zinc finger
IPR015880 446 468 SM00355 Zinc finger
IPR015880 474 496 SM00355 Zinc finger
IPR015880 502 524 SM00355 Zinc finger
IPR015880 530 552 SM00355 Zinc finger
IPR015880 558 580 SM00355 Zinc finger
IPR015880 605 627 SM00355 Zinc finger
IPR015880 634 656 SM00355 Zinc finger
IPR015880 689 711 SM00355 Zinc finger
IPR015880 717 739 SM00355 Zinc finger
IPR015880 745 767 SM00355 Zinc finger
IPR015880 773 795 SM00355 Zinc finger
IPR015880 801 823 SM00355 Zinc finger
IPR015880 829 851 SM00355 Zinc finger
IPR015880 857 879 SM00355 Zinc finger
IPR015880 885 907 SM00355 Zinc finger
ProfileScan IPR001909 49 118 PS50805 KRAB box
IPR007087 252 279 PS50157 Zinc finger
IPR007087 308 334 PS50157 Zinc finger
IPR007087 363 390 PS50157 Zinc finger
IPR007087 390 417 PS50157 Zinc finger
IPR007087 418 445 PS50157 Zinc finger
IPR007087 446 473 PS50157 Zinc finger
IPR007087 474 501 PS50157 Zinc finger
IPR007087 502 529 PS50157 Zinc finger
IPR007087 530 557 PS50157 Zinc finger
IPR007087 558 585 PS50157 Zinc finger
IPR007087 605 632 PS50157 Zinc finger
IPR007087 634 661 PS50157 Zinc finger
IPR007087 689 716 PS50157 Zinc finger
IPR007087 717 744 PS50157 Zinc finger
IPR007087 745 772 PS50157 Zinc finger
IPR007087 773 800 PS50157 Zinc finger
IPR007087 801 828 PS50157 Zinc finger
IPR007087 829 856 PS50157 Zinc finger
IPR007087 857 884 PS50157 Zinc finger
IPR007087 885 912 PS50157 Zinc finger
ScanRegExp IPR007087 254 274 PS00028 Zinc finger
IPR007087 365 385 PS00028 Zinc finger
IPR007087 392 412 PS00028 Zinc finger
IPR007087 420 440 PS00028 Zinc finger
IPR007087 476 496 PS00028 Zinc finger
IPR007087 504 524 PS00028 Zinc finger
IPR007087 532 552 PS00028 Zinc finger
IPR007087 560 580 PS00028 Zinc finger
IPR007087 607 627 PS00028 Zinc finger
IPR007087 636 656 PS00028 Zinc finger
IPR007087 691 711 PS00028 Zinc finger
IPR007087 719 739 PS00028 Zinc finger
IPR007087 747 767 PS00028 Zinc finger
IPR007087 775 795 PS00028 Zinc finger
IPR007087 803 823 PS00028 Zinc finger
IPR007087 831 851 PS00028 Zinc finger
IPR007087 859 879 PS00028 Zinc finger
IPR007087 887 907 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ATCATTCACCATTTATCCAGG
Primer_r GTCAACTAACAGCAATCGTCG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp