KIAA1151

Product ID	ORK05639
Accession No	AB032977
Description	neuron navigator 1
Clone name	ff11693
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (10693 bp) Predicted protein sequence (1770 aa)
Source	Human fetal brain
Rouge ID	mKIAA1151 by Kazusa Mouse cDNA Project
Note	We replaced hg02280 and bf00034, former representative clones for KIAA1151 with ff11693. (2002/5/10,2005/08/06)

Length: 10693 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	5379 bp
Genome contig ID	gi89161185f_199784740
PolyA signal sequence (None)	+--------+--------+----*----+---- ATTCCGAGCTGATTATGTAATAGGATGGAAAAAGT
Flanking genome sequence (276340 - 276389)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAATCTAATTTGTATTTCCATGACAACGTGTTCTCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	199884740	200061078	29	99.4	Perfect prediction

Length: 1770 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8NEY1	99.9	Neuron navigato...	Homo sapiens
CAD32470	99.8	steerin1 protei...	Homo sapiens
AAL05591	99.8	neuron navigato...	Homo sapiens
EAW91374	99.7	neuron navigato...	Homo sapiens
XP_848581	96.8	similar to neur...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033039	5.3e-78	95.1	KIAA1213
AB037840	3.5e-56	42.5	KIAA1419
AB023155	4.2e-49	42.7	KIAA0938

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR003593	1443	1597	SM00382	AAA+ ATPase
ScanRegExp	IPR008162	272	278	PS00387	Inorganic pyrophosphatase

Primer_f	TCCTTATTCCTTGGCACTGAC
Primer_r	CCATGAGCCAGAACTTGTGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-