KIAA1419

Product ID	ORK01690
Accession No	AB037840
Description	neuron navigator 2, transcript variant 2
Clone name	ff01653
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (11000 bp) Predicted protein sequence (2464 aa)
HaloTag ORF Clone	FHC01690
Flexi ORF Clone	FXC01690
Source	Human fetal brain
Note	We replaced hj05749 and ph01228, former representative clones for KIAA1419 with ff01653. (2002/5/10,2002/7/05)

Length: 11000 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3339 bp
Genome contig ID	gi51511727f_19591457
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- ATTCATGATTCAATAAAATTGATGCTTATTTATTC
Flanking genome sequence (508265 - 508314)	----+--------+--------+--------+--------+----* AGATTAGTGGTTTGGCTTGTCTGTGCTAGAGCAAGTCCTCATAGGAGTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	19691457	20099720	38	99.4	Perfect prediction

Length: 2464 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAL96480	100.0	retinoic acid i...	Homo sapiens
NP_892009	100.0	neuron navigato...	Homo sapiens
AAL96479	99.9	retinoic acid i...	Homo sapiens
NP_660093	99.8	neuron navigato...	Homo sapiens
BAC00854	99.8	helicase [Homo ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023155	1.2e-95	55.4	KIAA0938
AB032977	2.8e-46	42.5	KIAA1151
AB033039	1.1e-09	35.5	KIAA1213

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001715	118	224	PF00307	Calponin-like actin-binding
HMMSmart	IPR001715	119	222	SM00033	Calponin-like actin-binding
HMMSmart	IPR003593	2125	2279	SM00382	AAA+ ATPase
ProfileScan	IPR001715	117	224	PS50021	Calponin-like actin-binding

Primer_f	CTTTGTACTCATTTAGGGCTC
Primer_r	GTATCATTCTTGGCAGTTTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-