Order Kazusa clone(s) from : ![]() |
Product ID | ORK01690 |
---|---|
Accession No | AB037840 |
Description | neuron navigator 2, transcript variant 2 |
Clone name | ff01653 |
Vector information | |
cDNA sequence | DNA sequence (11000 bp) Predicted protein sequence (2464 aa) |
HaloTag ORF Clone |
FHC01690
![]() |
Flexi ORF Clone | FXC01690 |
Source | Human fetal brain |
Note | We replaced hj05749 and ph01228, former representative clones for KIAA1419 with ff01653. (2002/5/10,2002/7/05) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3339 bp |
---|---|
Genome contig ID | gi51511727f_19591457 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (508265 - 508314) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | f | 19691457 | 20099720 | 38 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Primer_f | CTTTGTACTCATTTAGGGCTC |
---|---|
Primer_r | GTATCATTCTTGGCAGTTTGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |