Order Kazusa clone(s) from : ![]() |
Product ID | ORK06102 |
---|---|
Accession No | AB023155 |
Description | neuron navigator 3 |
Clone name | hh04777s1 |
Vector information | |
cDNA sequence | DNA sequence (6268 bp) Predicted protein sequence (1257 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0938
by Kazusa Mouse cDNA Project
|
Note | We replaced hh04777, former representative clones for KIAA0938 with hh04777s1. (2003/8/28) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2493 bp |
---|---|
Genome contig ID | gi89161190f_76935955 |
PolyA signal sequence (ATTAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (194966 - 195015) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | f | 77035955 | 77130919 | 24 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TCAGTCATTGGAGAAGTTACC |
---|---|
Primer_r | GACCTATTGACTTTGTGACAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |