|
Order Kazusa clone(s) from : |
| Product ID | ORK06101 |
|---|---|
| Accession No | AB033039 |
| Description | neuron navigator 1 |
| Clone name | fh01142 |
| Vector information | |
| cDNA sequence | DNA sequence (5405 bp) Predicted protein sequence (484 aa) |
| Source | Human fetal brain |
| Note | Please refer to "Gene/Protein Characteristic Table for KIAA1151" because the cDNA sequence of KIAA1213 is included in KIAA1151. |
Length: 5405 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Length: 484 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RT-PCR-ELISA
|
Experimental conditions| Primer_f | CAGACAGATCGGGAAAAGGAG |
|---|---|
| Primer_r | GTTCTTGGGAGTACTTTCTGG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 1
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | ATTCCTCACTGTTTCACCCTG |
| Primer_r | GGAAAGCACTGGAAGAACGAG |
| PCR product length | 174 bp |
| PCR conditions | 95 °C 15 sec 64 °C 60 sec 30 cycles |