Gene/Protein Characteristic Table for KIAA1213
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06101
Accession No AB033039
Description neuron navigator 1
Clone name fh01142
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5405 bp)
Predicted protein sequence (484 aa)
Source Human fetal brain
Note Please refer to "Gene/Protein Characteristic Table for KIAA1151" because the cDNA sequence of KIAA1213 is included in KIAA1151.
Features of the cloned cDNA sequence
Description

Length: 5405 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 484 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAI17012 9.7e-138 96.7 neuron navigato...
Homo sapiens
BAB14142 9.2e-137 96.0 unnamed protein...
Homo sapiens
CAI17011 3.2e-136 95.1 neuron navigato...
Homo sapiens
CAD32470 3.8e-136 95.1 steerin1 protei...
Homo sapiens
EAW91374 3.8e-136 95.1 neuron navigato...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB032977 5.3e-80 95.1 KIAA1151
AB037840 3.1e-12 35.4 KIAA1419
AB023155 5.6e-11 36.7 KIAA0938
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CAGACAGATCGGGAAAAGGAG
Primer_r GTTCTTGGGAGTACTTTCTGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name GeneBridge 4
Primer_f ATTCCTCACTGTTTCACCCTG
Primer_r GGAAAGCACTGGAAGAACGAG
PCR product length 174 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp