KIAA1179

Gene/Protein Characteristic Table for KIAA1179

Order Kazusa clone(s) from :

Product ID	ORK05493
Accession No	AB033005
Description	intraflagellar transport 172
Clone name	hh05402a
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3326 bp) Predicted protein sequence (1090 aa)
Source	Human adult brain
Rouge ID	mKIAA1179 by Kazusa Mouse cDNA Project

Length: 3326 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	53 bp
Genome contig ID	gi89161199r_27420750
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- AGTTAGGGCCTCTCCCTCATTAAAGTTTTATAAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTGAGACCACTGTATTCTTTGATCAAAGTCATTCCCAACACCACACAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	27520750	27539512	30	99.9	Perfect prediction

Features of the protein sequence

Description

Length: 1090 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAB53678	100.0	hypothetical pr...	Homo sapiens
Q9UG01	100.0	Intraflagellar ...	Homo sapiens
EAX00571	99.7	intraflagellar ...	Homo sapiens
XP_001097501	99.5	similar to sele...	Macaca mulatta
XP_001502238	96.1	similar to intr...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046858	1.2e-06	22.4	KIAA1638
AB011162	3.2e-05	23.2	KIAA0590

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TATGGCGGAGAAGGAACAGAC
Primer_r	TTCAGCCACAGCGATACACTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 2

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TATGGCGGAGAAGGAACAGAC
Primer_r	TTCAGCCACAGCGATACACTC
PCR product length	168 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp