KIAA1638

Product ID	ORK07350
Accession No	AB046858
Description	WD repeat domain 19
Clone name	fj04819s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326 vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. pYO326 shuttle vector, pYO326 (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (3095 bp) Predicted protein sequence (905 aa)
Source	Human fetal brain
Rouge ID	mKIAA1638 by Kazusa Mouse cDNA Project
Note	We replaced fj04819, former representative clones for KIAA1638 with fj04819s1. (2002/5/10)

Length: 3095 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	377 bp
Genome contig ID	gi89161207f_38793897
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGGGCAACAGAGTGAGACCCCATCTC
Flanking genome sequence (159459 - 159508)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAGATGGGCATATCAATTAGGATTGTATTTAGCTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	38893897	38953354	23	100.0	Perfect prediction

Length: 905 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG57877	100.0	unnamed protein...	Homo sapiens
EAW92917	100.0	WD repeat domai...	Homo sapiens
Q8NEZ3	100.0	WD repeat-conta...	Homo sapiens
AAK38745	100.0	WD repeat membr...	Homo sapiens
XP_517152	99.8	WD repeat domai...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033005	3.4e-08	22.0	KIAA1179
AB037795	9.5e-05	20.6	KIAA1374
AB011162	0.00019	22.3	KIAA0590

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000547	568	636	PF00637	Clathrin

Primer_f	GGCTCACTTCATGTTTTCCTG
Primer_r	AGAAACTGTGATTGGTAGCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	CAGTGGCAAAGTGTAATCCGC
Primer_r	GCTTCATTGTTGCATTTGGAC
PCR product length	182 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles