Order Kazusa clone(s) from : ![]() |
Product ID | ORK00767 |
---|---|
Accession No | AB033032 |
Description | plexin B3, transcript variant 1 |
Clone name | fg04331 |
Vector information | |
cDNA sequence | DNA sequence (6145 bp) Predicted protein sequence (1912 aa) |
HaloTag ORF Clone |
FHC00767
![]() |
Flexi ORF Clone | FXC00767 |
Source | Human fetal brain |
Rouge ID |
mKIAA1206
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 301 bp |
---|---|
Genome contig ID | gi89161218f_152582905 |
PolyA signal sequence (AATAAA,-29) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (115086 - 115135) |
----+----*----+----*----+----*----+----*----+----* |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001627 | 57 | 150 | PF01403 | Semaphorin/CD100 antigen |
IPR002165 | 476 | 529 | PF01437 | Plexin | |
IPR002165 | 790 | 836 | PF01437 | Plexin | |
IPR002909 | 838 | 927 | PF01833 | Cell surface receptor IPT/TIG | |
IPR002909 | 930 | 1014 | PF01833 | Cell surface receptor IPT/TIG | |
IPR002909 | 1018 | 1147 | PF01833 | Cell surface receptor IPT/TIG | |
IPR002909 | 1162 | 1246 | PF01833 | Cell surface receptor IPT/TIG | |
IPR013548 | 1329 | 1879 | PF08337 | Plexin cytoplasmic region | |
HMMSmart | IPR001627 | 57 | 458 | SM00630 | Semaphorin/CD100 antigen |
IPR003659 | 476 | 529 | SM00423 | Plexin/semaphorin/integrin | |
IPR003659 | 623 | 685 | SM00423 | Plexin/semaphorin/integrin | |
IPR003659 | 790 | 836 | SM00423 | Plexin/semaphorin/integrin | |
IPR002909 | 837 | 928 | SM00429 | Cell surface receptor IPT/TIG | |
IPR002909 | 929 | 1015 | SM00429 | Cell surface receptor IPT/TIG | |
IPR002909 | 1017 | 1148 | SM00429 | Cell surface receptor IPT/TIG | |
ProfileScan | IPR001627 | 34 | 474 | PS51004 | Semaphorin/CD100 antigen |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 24 | RWPPFGLCLLLLLLSPPPLPLTG | 46 | SECONDARY | 23 | 2 | 1261 | VGMGAAVLIAAVLLLTLMYR | 1280 | PRIMARY | 20 |
---|
![]() |
Primer_f | TTCATTGACTCCTGTACCACC |
---|---|
Primer_r | AGTTCATCTCCTGGTAGCTCG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTCATTGACTCCTGTACCACC |
Primer_r | AGTTCATCTCCTGGTAGCTCG |
PCR product length | 160(400) bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |