Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00501 |
---|---|
Accession No | AB002313 |
Description | plexin B2 |
Clone name | hg00246 |
Vector information | |
cDNA sequence | DNA sequence (6252 bp) Predicted protein sequence (1841 aa) |
HaloTag ORF Clone |
FHC00501
|
Flexi ORF Clone | FXC00501 |
Source | Human adult brain |
Rouge ID |
mKIAA0315
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001627 | 37 | 452 | PF01403 | Semaphorin/CD100 antigen |
IPR002165 | 471 | 522 | PF01437 | Plexin | |
IPR002165 | 762 | 804 | PF01437 | Plexin | |
IPR002909 | 806 | 895 | PF01833 | Cell surface receptor IPT/TIG | |
IPR002909 | 898 | 981 | PF01833 | Cell surface receptor IPT/TIG | |
IPR002909 | 986 | 1094 | PF01833 | Cell surface receptor IPT/TIG | |
IPR013548 | 1273 | 1808 | PF08337 | Plexin cytoplasmic region | |
HMMSmart | IPR001627 | 37 | 453 | SM00630 | Semaphorin/CD100 antigen |
IPR003659 | 471 | 522 | SM00423 | Plexin/semaphorin/integrin | |
IPR003659 | 617 | 670 | SM00423 | Plexin/semaphorin/integrin | |
IPR003659 | 762 | 804 | SM00423 | Plexin/semaphorin/integrin | |
IPR002909 | 805 | 896 | SM00429 | Cell surface receptor IPT/TIG | |
IPR002909 | 897 | 983 | SM00429 | Cell surface receptor IPT/TIG | |
IPR002909 | 985 | 1095 | SM00429 | Cell surface receptor IPT/TIG | |
ProfileScan | IPR001627 | 11 | 469 | PS51004 | Semaphorin/CD100 antigen |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 3 | AMALQLWALTLLGLLGAGASLR | 24 | PRIMARY | 22 | 2 | 1199 | VPLSLILPLVIVPMVVVIAVSV | 1220 | PRIMARY | 22 |
---|
RT-PCR |
---|
Primer_f | ACTTGACCTTTGACGTGGGGC |
---|---|
Primer_r | ACGATGCCTTCCTGACCTCAC |
PCR conditions | 95 °C15 sec64 °C15 sec72 °C45 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ACTTGACCTTTGACGTGGGGC |
Primer_r | ACGATGCCTTCCTGACCTCAC |
PCR product length | 90 bp |
PCR conditions | 95 °C15 sec66 °C60 sec30 cycles |