Gene/Protein Characteristic Table for KIAA0620
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00578
Accession No AB014520
Description plexin D1
Clone name hg04174
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6753 bp)
Predicted protein sequence (1984 aa)
Flexi ORF Clone FXC00578
Source Human adult brain
Rouge ID mKIAA0620 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6753 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1984 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9Y4D7 0 100.0 Plexin-D1; Flag...
Homo sapiens
NP_055918 0 99.9 plexin D1 [Homo...
Homo sapiens
XP_533732 0 93.6 similar to plex...
Canis lupus fam...
BAE27964 0 91.4 unnamed protein...
Mus musculus
AAT99561 0 91.4 plexin D1 [Mus ...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB002313 1.1e-65 35.0 KIAA0315
AB007867 2.9e-36 32.7 KIAA0407
AB007932 4.5e-32 33.0 KIAA0463
AB046770 1.9e-31 36.2 KIAA1550
AB033032 2.5e-31 35.5 KIAA1206
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001627 119 589 PF01403 Semaphorin/CD100 antigen
IPR002165 608 661 PF01437 Plexin
IPR002165 761 813 PF01437 Plexin
IPR002909 951 1038 PF01833 Cell surface receptor IPT/TIG
IPR002909 1041 1125 PF01833 Cell surface receptor IPT/TIG
IPR002909 1129 1210 PF01833 Cell surface receptor IPT/TIG
IPR013548 1404 1948 PF08337 Plexin cytoplasmic region
HMMSmart IPR001627 119 589 SM00630 Semaphorin/CD100 antigen
IPR003659 608 661 SM00423 Plexin/semaphorin/integrin
IPR003659 761 813 SM00423 Plexin/semaphorin/integrin
IPR003659 908 949 SM00423 Plexin/semaphorin/integrin
IPR002909 950 1039 SM00429 Cell surface receptor IPT/TIG
IPR002909 1040 1126 SM00429 Cell surface receptor IPT/TIG
IPR002909 1128 1207 SM00429 Cell surface receptor IPT/TIG
ProfileScan IPR001627 96 606 PS51004 Semaphorin/CD100 antigen

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 1329 ETAIIVSIVICSVLLLLSVVALF 1351 PRIMARY 23
Expression profile
Description

RT-PCR
RT-PCR-ELISA
Experimental conditions
Primer_f CAGATTTTTGTTGCTTGGGCG
Primer_r TTTCAGCAAGATCAAGTAGCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 3
Experimental conditions
Panel name GeneBridge 4
Primer_f CAGATTTTTGTTGCTTGGGCG
Primer_r TTTCAGCAAGATCAAGTAGCC
PCR product length 196 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp