Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00578 |
---|---|
Accession No | AB014520 |
Description | plexin D1 |
Clone name | hg04174 |
Vector information | |
cDNA sequence | DNA sequence (6753 bp) Predicted protein sequence (1984 aa) |
HaloTag ORF Clone |
FHC00578
|
Flexi ORF Clone | FXC00578 |
Source | Human adult brain |
Rouge ID |
mKIAA0620
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001627 | 119 | 589 | PF01403 | Semaphorin/CD100 antigen |
IPR002165 | 608 | 661 | PF01437 | Plexin | |
IPR002165 | 761 | 813 | PF01437 | Plexin | |
IPR002909 | 951 | 1038 | PF01833 | Cell surface receptor IPT/TIG | |
IPR002909 | 1041 | 1125 | PF01833 | Cell surface receptor IPT/TIG | |
IPR002909 | 1129 | 1210 | PF01833 | Cell surface receptor IPT/TIG | |
IPR013548 | 1404 | 1948 | PF08337 | Plexin cytoplasmic region | |
HMMSmart | IPR001627 | 119 | 589 | SM00630 | Semaphorin/CD100 antigen |
IPR003659 | 608 | 661 | SM00423 | Plexin/semaphorin/integrin | |
IPR003659 | 761 | 813 | SM00423 | Plexin/semaphorin/integrin | |
IPR003659 | 908 | 949 | SM00423 | Plexin/semaphorin/integrin | |
IPR002909 | 950 | 1039 | SM00429 | Cell surface receptor IPT/TIG | |
IPR002909 | 1040 | 1126 | SM00429 | Cell surface receptor IPT/TIG | |
IPR002909 | 1128 | 1207 | SM00429 | Cell surface receptor IPT/TIG | |
ProfileScan | IPR001627 | 96 | 606 | PS51004 | Semaphorin/CD100 antigen |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1329 | ETAIIVSIVICSVLLLLSVVALF | 1351 | PRIMARY | 23 |
---|
RT-PCR |
---|
RT-PCR-ELISA |
Primer_f | CAGATTTTTGTTGCTTGGGCG |
---|---|
Primer_r | TTTCAGCAAGATCAAGTAGCC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CAGATTTTTGTTGCTTGGGCG |
Primer_r | TTTCAGCAAGATCAAGTAGCC |
PCR product length | 196 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |