Order Kazusa clone(s) from : 
Japan
||
Other countries |
|
Order Kazusa clone(s) from :
Japan
||
Other countries |
| Product ID | ORK06405 |
|---|---|
| Accession No | AB046770 |
| Description | plexin A4 |
| Clone name | ff03434 |
| Vector information |
The cDNA fragment was inserted at the SalI-NotI site of the ...
|
| cDNA sequence | DNA sequence (11518 bp) Predicted protein sequence (1462 aa) |
| Source | Human fetal brain |
| Rouge ID |
mKIAA1550
by Kazusa Mouse cDNA Project
|
| Note | We replaced fh16159 and fh16159s1, former representative clones for KIAA1550 with ff03434. (2002/5/10,2005/08/06) |
Length: 11518 bp Physical map
Restriction map Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | Warning |
Integrity of 3' end
| Length of 3'UTR | 7127 bp |
|---|---|
| Genome contig ID | gi89161213r_131358640 |
| PolyA signal sequence (AATAAA,-11) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 7 | r | 131458640 | 131824667 | 30 | 99.4 | Perfect prediction |
Length: 1462 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment) |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment) |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI) Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR001627 | 1 | 58 | PF01403 | Semaphorin/CD100 antigen |
| IPR002165 | 77 | 127 | PF01437 | Plexin | |
| IPR002165 | 223 | 270 | PF01437 | Plexin | |
| IPR002165 | 371 | 424 | PF01437 | Plexin | |
| IPR002909 | 426 | 519 | PF01833 | Cell surface receptor IPT/TIG | |
| IPR002909 | 522 | 604 | PF01833 | Cell surface receptor IPT/TIG | |
| IPR002909 | 608 | 706 | PF01833 | Cell surface receptor IPT/TIG | |
| IPR002909 | 710 | 797 | PF01833 | Cell surface receptor IPT/TIG | |
| IPR013548 | 878 | 1432 | PF08337 | Plexin cytoplasmic region | |
| HMMSmart | IPR003659 | 77 | 127 | SM00423 | Plexin/semaphorin/integrin |
| IPR003659 | 223 | 270 | SM00423 | Plexin/semaphorin/integrin | |
| IPR003659 | 371 | 424 | SM00423 | Plexin/semaphorin/integrin | |
| IPR002909 | 425 | 519 | SM00429 | Cell surface receptor IPT/TIG | |
| IPR002909 | 521 | 605 | SM00429 | Cell surface receptor IPT/TIG | |
| IPR002909 | 607 | 707 | SM00429 | Cell surface receptor IPT/TIG | |
| IPR002909 | 709 | 798 | SM00429 | Cell surface receptor IPT/TIG | |
| ProfileScan | IPR001627 | 1 | 75 | PS51004 | Semaphorin/CD100 antigen |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 805 | PAIVSIAVAGGLLIIFIVAVLIA | 827 | PRIMARY | 23 |
|---|
|
RT-PCR-ELISA
|
Experimental conditions| Primer_f | CTAGAGATGAAGGTGTCGGTG |
|---|---|
| Primer_r | ATCTGGGGGTTCTGTATGAGG |
| PCR conditions | 95 °C 30 sec55 °C30 sec72 °C60 sec30 cycles |
Chromosome No. 7 Experimental conditions| Panel name | CCR |
|---|---|
| Primer_f | CTAGAGATGAAGGTGTCGGTG |
| Primer_r | ATCTGGGGGTTCTGTATGAGG |
| PCR product length | 176(2k) bp |
| PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |
Japan
||
Other countries
