KIAA1348

Product ID	ORK00810
Accession No	AB037769
Description	pyruvate dehyrogenase phosphatase catalytic subunit 2
Clone name	fj00937
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3830 bp) Predicted protein sequence (545 aa)
HaloTag ORF Clone	FHC00810
Flexi ORF Clone	FXC00810
Source	Human fetal brain
Rouge ID	mKIAA1348 by Kazusa Mouse cDNA Project

Length: 3830 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2078 bp
Genome contig ID	gi51511732f_65371937
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCAGCCTGGGCAACAAGAGTGAAACTCTGTCTC
Flanking genome sequence (107421 - 107470)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAATCCATCTTATCTCTTAGTCCGTCCTTCCTTCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	65471937	65479356	2	99.0	Perfect prediction

Length: 545 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9P2J9	0	100.0	[Pyruvate dehyd...	Homo sapiens
XP_001159664	0	99.8	pyruvate dehydr...	Pan troglodytes
CAH91302	0	98.9	hypothetical pr...	Pongo abelii
XP_001085713	0	98.9	pyruvate dehydr...	Macaca mulatta
XP_001496201	5.2e-207	89.2	similar to pyru...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032983	0.00032	24.4	KIAA1157

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014045	121	503	PF00481	Protein phosphatase 2C
HMMSmart	IPR001932	109	531	SM00332	Protein phosphatase 2C-related
ScanRegExp	IPR000222	152	160	PS01032	Protein phosphatase 2C

Primer_f	ACCACCATTGCTAGTCCTCAG
Primer_r	CAAAGAGTCTACAGCCCACAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ACCACCATTGCTAGTCCTCAG
Primer_r	CAAAGAGTCTACAGCCCACAG
PCR product length	104 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles