KIAA1157

Product ID	ORK06453
Accession No	AB032983
Description	protein phosphatase, Mg2+/Mn2+ dependent, 1H
Clone name	hh05862
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5791 bp) Predicted protein sequence (428 aa)
Source	Human adult brain
Rouge ID	mKIAA1157 by Kazusa Mouse cDNA Project

Length: 5791 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4504 bp
Genome contig ID	gi89161190r_61224066
PolyA signal sequence (None)	+--------+--------+----*----+---- AAATATTATATATATGTATATACGACATATTCAGC
Flanking genome sequence (99967 - 99918)	----+--------+--------+--------+--------+----* AAAACTTTTTTCTGTCTTTTCTATGAATTCACTGTGAAGTTTCTTTGTAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	61324033	61512313	9	99.2	Perfect prediction

Length: 428 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW97111	9.2e-182	100.0	hCG40446, isofo...	Homo sapiens
AAI57844	9.8e-182	100.0	Protein phospha...	Homo sapiens
Q9ULR3	9.8e-182	100.0	Protein phospha...	Homo sapiens
XP_001116776	1e-180	98.8	similar to prot...	Macaca mulatta
XP_871615	2.6e-177	96.5	similar to Prot...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037769	0.00076	25.3	KIAA1348

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014045	24	400	PF00481	Protein phosphatase 2C
HMMSmart	IPR001932	14	419	SM00332	Protein phosphatase 2C-related

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	179	ISGGCTALIVICLLGKLYVANAG	201	PRIMARY	23

Primer_f	TTAGAACAAACTCAGTCCGTC
Primer_r	CAAGAACAGCAGATAGGTATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-