KIAA1372

Product ID	ORK00220
Accession No	AB037793
Description	ubiquitin specific peptidase 35
Clone name	fj03335
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3771 bp) Predicted protein sequence (773 aa)
HaloTag ORF Clone	FHC00220
Flexi ORF Clone	FXC00220
Source	Human fetal brain
Rouge ID	mKIAA1372 by Kazusa Mouse cDNA Project

Length: 3771 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	895 bp
Genome contig ID	gi51511727f_77487664
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CCCATGTTCATAAATAAATAAAAGTAAGCCTAAGC
Flanking genome sequence (115739 - 115788)	----+--------+--------+--------+--------+----* AAGAGATTGTTCTTCCTTGGACTCAGGGGCTGTGATGGCCACTGGGTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	77587664	77603401	8	99.7	Perfect prediction

Length: 773 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_065849	99.5	ubiquitin speci...	Homo sapiens
Q9P2H5	99.3	Ubiquitin carbo...	Homo sapiens
BAG11313	100.0	ubiquitin carbo...	synthetic construct
EAW75056	99.9	hCG27473 [Homo ...	Homo sapiens
XP_891616	85.2	ubiquitin speci...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067478	1e-34	43.8	KIAA1891

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001394	193	678	PF00443	Peptidase C19
ProfileScan	IPR001394	196	682	PS50235	Peptidase C19
ScanRegExp	IPR001394	197	212	PS00972	Peptidase C19
ScanRegExp	IPR001394	600	618	PS00973	Peptidase C19

Primer_f	GTATCCCCCTTGTGGTTAGAG
Primer_r	ACAAAGGCCAACTGCTCAGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTTCTCTTTCGACCTGCGCAC
Primer_r	CATAGCAGTAGTAGTGACCAC
PCR product length	170 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles