KIAA1891

Product ID	ORK07319
Accession No	AB067478
Description	ubiquitin specific peptidase 38
Clone name	fk02783
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3373 bp) Predicted protein sequence (780 aa)
Source	Human fetal brain
Rouge ID	mKIAA1891 by Kazusa Mouse cDNA Project

Length: 3373 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1029 bp
Genome contig ID	gi89161207f_144236316
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- TACTTATTCCTCAGAATATTAAACATTGATCACAT
Flanking genome sequence (125775 - 125824)	----+--------+--------+--------+--------+----* ATTTTTAGAGTTTTACATTTGGGTTTTTTGTTTGTTTGTTTCAGTCATAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	144328532	144362089	9	99.2	Perfect prediction

Length: 780 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8NB14	100.0	Ubiquitin carbo...	Homo sapiens
XP_517457	99.5	hypothetical pr...	Pan troglodytes
XP_001092815	97.7	similar to ubiq...	Macaca mulatta
XP_001502179	93.2	ubiquitin speci...	Equus caballus
XP_533279	92.3	similar to ubiq...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037793	1.4e-53	43.8	KIAA1372
AB028980	0.00018	26.5	KIAA1057
AB011142	0.001	21.7	KIAA0570

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001394	180	684	PF00443	Peptidase C19
ProfileScan	IPR001394	183	688	PS50235	Peptidase C19
ScanRegExp	IPR001394	184	199	PS00972	Peptidase C19
ScanRegExp	IPR001394	578	596	PS00973	Peptidase C19

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	30	ALLKGLAAVQKFTILIDVTLLKI	52	PRIMARY	23

Primer_f	TCTGCTTCATGTTCATTTCGG
Primer_r	GTGCATTTTGGACTCTCTCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-