Gene/Protein Characteristic Table for KIAA1891
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07319
Accession No AB067478
Description ubiquitin specific peptidase 38
Clone name fk02783
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3373 bp)
Predicted protein sequence (780 aa)
Source Human fetal brain
Rouge ID mKIAA1891 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3373 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 1029 bp
Genome contig ID gi89161207f_144236316
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
TACTTATTCCTCAGAATATTAAACATTGATCACAT
Flanking genome sequence
(125775 - 125824)
----+----*----+----*----+----*----+----*----+----*
ATTTTTAGAGTTTTACATTTGGGTTTTTTGTTTGTTTGTTTCAGTCATAT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 4 f 144328532 144362089 9 99.2 Perfect prediction
Features of the protein sequence
Description

Length: 780 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8NB14 0 100.0 Ubiquitin carbo...
Homo sapiens
XP_517457 0 99.5 hypothetical pr...
Pan troglodytes
XP_001092815 0 97.7 similar to ubiq...
Macaca mulatta
XP_001502179 0 93.2 ubiquitin speci...
Equus caballus
XP_533279 0 92.3 similar to ubiq...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB037793 1.4e-53 43.8 KIAA1372
AB028980 0.00018 26.5 KIAA1057
AB011142 0.001 21.7 KIAA0570
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001394 180 684 PF00443 Peptidase C19
ProfileScan IPR001394 183 688 PS50235 Peptidase C19
ScanRegExp IPR001394 184 199 PS00972 Peptidase C19
IPR001394 578 596 PS00973 Peptidase C19

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 30 ALLKGLAAVQKFTILIDVTLLKI 52 PRIMARY 23
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TCTGCTTCATGTTCATTTCGG
Primer_r GTGCATTTTGGACTCTCTCAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 4
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp