Gene/Protein Characteristic Table for KIAA1388
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00821
Accession No AB037809
Description zinc finger protein 319
Clone name fj06552
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4220 bp)
Predicted protein sequence (599 aa)
Flexi ORF Clone FXC00821
Source Human fetal brain
Rouge ID mKIAA1388 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4220 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 1848 bp
Genome contig ID gi51511732r_56486074
PolyA signal sequence
(AGTAAA,-31)		 
+----*----+----*----+----*----+----
TAGAAGTAAAGACATTGACCGTCACAGACCACTGC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
ACTGCTTGTTCTGCTCCTTCTTCCACAGGGGAACGATGGACATGGAGAGG

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 16 r 56586074 56591263 2 99.1 Perfect prediction
Features of the protein sequence
Description

Length: 599 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9P2F9 2.4e-204 100.0 Zinc finger pro...
 Homo sapiens
XP_001100953 4.8e-204 99.8 zinc finger pro...
 Macaca mulatta
XP_001915409 1.1e-200 97.8 similar to Zinc...
 Equus caballus
XP_544384 1.9e-199 97.3 similar to Zinc...
 Canis lupus fam...
EDL87291 2.4e-199 96.9 rCG39161 [Rattu...
 Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB040906 5.4e-28 35.6 KIAA1473
AB051497 1e-26 41.7 KIAA1710
AB075836 2e-26 35.5 KIAA1956
AB037852 2.8e-26 37.3 KIAA1431
AB058774 5.2e-26 33.5 KIAA1871
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 247 270 PD000003 Zinc finger
IPR007087 332 355 PD000003 Zinc finger
IPR007087 504 526 PD000003 Zinc finger
IPR007087 531 550 PD000003 Zinc finger
HMMPfam IPR007087 149 171 PF00096 Zinc finger
IPR007087 219 241 PF00096 Zinc finger
IPR007087 247 269 PF00096 Zinc finger
IPR007087 275 297 PF00096 Zinc finger
IPR007087 332 354 PF00096 Zinc finger
IPR007087 360 382 PF00096 Zinc finger
IPR007087 388 410 PF00096 Zinc finger
IPR007087 445 467 PF00096 Zinc finger
IPR007087 503 525 PF00096 Zinc finger
IPR007087 531 553 PF00096 Zinc finger
HMMSmart IPR015880 121 141 SM00355 Zinc finger
IPR015880 149 171 SM00355 Zinc finger
IPR015880 219 241 SM00355 Zinc finger
IPR015880 247 269 SM00355 Zinc finger
IPR015880 275 297 SM00355 Zinc finger
IPR015880 332 354 SM00355 Zinc finger
IPR015880 360 382 SM00355 Zinc finger
IPR015880 388 410 SM00355 Zinc finger
IPR015880 416 436 SM00355 Zinc finger
IPR015880 445 467 SM00355 Zinc finger
IPR015880 475 495 SM00355 Zinc finger
IPR015880 503 525 SM00355 Zinc finger
IPR015880 531 553 SM00355 Zinc finger
IPR015880 559 581 SM00355 Zinc finger
ProfileScan IPR007087 121 148 PS50157 Zinc finger
IPR007087 149 176 PS50157 Zinc finger
IPR007087 219 246 PS50157 Zinc finger
IPR007087 247 274 PS50157 Zinc finger
IPR007087 275 302 PS50157 Zinc finger
IPR007087 304 331 PS50157 Zinc finger
IPR007087 332 359 PS50157 Zinc finger
IPR007087 360 387 PS50157 Zinc finger
IPR007087 388 415 PS50157 Zinc finger
IPR007087 416 444 PS50157 Zinc finger
IPR007087 445 472 PS50157 Zinc finger
IPR007087 475 502 PS50157 Zinc finger
IPR007087 503 530 PS50157 Zinc finger
IPR007087 531 558 PS50157 Zinc finger
IPR007087 559 586 PS50157 Zinc finger
ScanRegExp IPR007087 95 117 PS00028 Zinc finger
IPR007087 151 171 PS00028 Zinc finger
IPR007087 221 241 PS00028 Zinc finger
IPR007087 249 269 PS00028 Zinc finger
IPR007087 277 297 PS00028 Zinc finger
IPR007087 334 354 PS00028 Zinc finger
IPR007087 362 382 PS00028 Zinc finger
IPR007087 390 410 PS00028 Zinc finger
IPR007087 447 467 PS00028 Zinc finger
IPR007087 505 525 PS00028 Zinc finger
IPR007087 533 553 PS00028 Zinc finger
IPR007087 561 581 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CACCATGCTTCTCTGTCACCG
Primer_r TAGCAGTTGGGACGGTTGTAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 16
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp