KIAA1416

Product ID	ORK04550
Accession No	AB037837
Description	chromodomain helicase DNA binding protein 7
Clone name	hh02957s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326GW (Amp-r) vector. The cDNA includes the following sequence (5'GTCGACCCAC GCGTCCGCCC ACGCGTCCG3') at the 5' portion and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. The original pYO326 shuttle vector (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (5901 bp) Predicted protein sequence (1966 aa)
Source	Human adult brain
Note	We replaced hh02957, former representative clones for KIAA1416 with hh02957s1. (2002/5/10)

Length: 5901 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	0 bp
Genome contig ID	gi51511724f_61775549
PolyA signal sequence (None)	+--------+--------+----*----+---- GAAGAAGGCCCAAAAGTGAGATCGCCAGAGCAGCC
Flanking genome sequence (164692 - 164741)	----+--------+--------+--------+--------+----* GCGGCCGCCGCTGCTGTGGCCTCCACGTCAGGGATCAACCCTTTGCTGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	f	61875549	61940239	34	100.0	Perfect prediction

Length: 1966 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2D1	100.0	Chromodomain-he...	Homo sapiens
XP_519780	99.9	chromodomain he...	Pan troglodytes
EAW86831	99.9	chromodomain he...	Homo sapiens
EAW86830	99.9	chromodomain he...	Homo sapiens
XP_001915803	97.5	similar to Chro...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046784	0	59.2	KIAA1564
AB002306	0	60.2	KIAA0308
AB037756	3.1e-152	47.8	KIAA1335
AB007913	2.6e-25	33.5	KIAA0444
AB002307	8.2e-17	30.9	KIAA0309

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000953	38	100	PF00385	Chromo
	IPR000953	120	173	PF00385	Chromo
	IPR000330	209	496	PF00176	SNF2-related
	IPR001650	563	642	PF00271	DNA/RNA helicase
	IPR006576	1802	1851	PF07533	BRK
	IPR006576	1880	1924	PF07533	BRK
HMMSmart	IPR000953	37	102	SM00298	Chromo
	IPR000953	118	175	SM00298	Chromo
	IPR014001	202	403	SM00487	DEAD-like helicases
	IPR001650	558	642	SM00490	DNA/RNA helicase
	IPR006576	1802	1851	SM00592	BRK
	IPR006576	1880	1924	SM00592	BRK
ProfileScan	IPR000953	38	105	PS50013	Chromo
	IPR000953	120	185	PS50013	Chromo
	IPR014021	218	392	PS51192	Helicase
	IPR001650	532	702	PS51194	DNA/RNA helicase

Primer_f	TCAGAAACCGAAACAGAAACG
Primer_r	GACTCAGGAACAAAACCAGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTGGGCCTGGATAAAGCTGTG
Primer_r	TTTAGACCCTTCATCCTCCTC
PCR product length	150 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles