KIAA0308

Product ID	ORK04552
Accession No	AB002306
Description	chromodomain helicase DNA binding protein 9
Clone name	ee00163
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (10256 bp) Predicted protein sequence (2759 aa)
Source
Rouge ID	mKIAA0308 by Kazusa Mouse cDNA Project
Note	We replaced hg00088 and hg00088s1, former representative clones for KIAA0308 with ee00163. (2003/8/28,2005/08/06)

Length: 10256 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1975 bp
Genome contig ID	gi51511732f_51647871
PolyA signal sequence (None)	+--------+--------+----*----+---- ACCCACATGATCTTTATTCCTTCCTTTCGCCAATT
Flanking genome sequence (270414 - 270463)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAGGAAAAAAAATCTGTAGATCTTGTCACTAAAATCTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	51747871	51918283	38	99.6	Perfect prediction

Length: 2759 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
ABD24032	99.9	PRIC320 isoform...	Homo sapiens
NP_079410	99.9	chromodomain he...	Homo sapiens
XP_001165654	99.8	chromodomain he...	Pan troglodytes
XP_510966	99.7	chromodomain he...	Pan troglodytes
AAT66509	99.4	KISH2; hKISH2; ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037837	2.5e-174	60.3	KIAA1416
AB046784	4.6e-168	52.8	KIAA1564
AB037756	2.7e-97	43.6	KIAA1335
AB007913	7e-17	47.3	KIAA0444
AB033085	7.1e-11	24.5	KIAA1259

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000953	567	629	PF00385	Chromo
	IPR000953	650	704	PF00385	Chromo
	IPR000330	740	1027	PF00176	SNF2-related
	IPR001650	1094	1173	PF00271	DNA/RNA helicase
	IPR006576	2344	2393	PF07533	BRK
	IPR006576	2418	2462	PF07533	BRK
HMMSmart	IPR000953	565	631	SM00298	Chromo
	IPR000953	648	706	SM00298	Chromo
	IPR014001	733	934	SM00487	DEAD-like helicases
	IPR001650	1089	1173	SM00490	DNA/RNA helicase
	IPR006576	2344	2393	SM00592	BRK
	IPR006576	2418	2462	SM00592	BRK
ProfileScan	IPR000953	567	630	PS50013	Chromo
	IPR000953	650	716	PS50013	Chromo
	IPR014021	749	923	PS51192	Helicase
	IPR001650	1063	1214	PS51194	DNA/RNA helicase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	775	FLYEILLTGIRGPFLIIAPLSTI	797	PRIMARY	23

Primer_f	GACTACACAAAACACAACTGG
Primer_r	GAAAAGTTGTCCAGCTATCAG
PCR conditions	95 °C15 sec64 °C15 sec72 °C45 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GACTACACAAAACACAACTGG
Primer_r	GAAAAGTTGTCCAGCTATCAG
PCR product length	268 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles