KIAA1259

Product ID	ORK00785
Accession No	AB033085
Description	INO80 complex subunit, transcript variant 1
Clone name	hh15706
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hh15706 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCGG ACGCGTGGG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (5979 bp) Predicted protein sequence (1561 aa)
HaloTag ORF Clone	FHC00785
Flexi ORF Clone	FXC00785
Source	Human adult brain
Rouge ID	mKIAA1259 by Kazusa Mouse cDNA Project

Length: 5979 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1095 bp
Genome contig ID	gi51511731r_38958383
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TGGATAAAAAAATCTTAAATAAAATGGAGTGAGAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTTTATGTAAATTGAGGTGTCTGTGGTCTTTGCAGCTGCCCCTCCTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	r	39058383	39195632	37	99.8	Perfect prediction

Length: 1561 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULG1	100.0	Putative DNA he...	Homo sapiens
XP_510320	99.9	INO80 complex h...	Pan troglodytes
XP_849183	98.3	similar to yeas...	Canis lupus fam...
XP_001503533	97.8	INO80 complex h...	Equus caballus
XP_874470	97.6	similar to Puta...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002307	5.4e-20	45.1	KIAA0309
AB007913	4.9e-15	47.6	KIAA0444
AB040931	6.4e-15	27.6	KIAA1498
AB032948	3.7e-14	25.8	KIAA1122
AB002306	1.1e-13	24.5	KIAA0308

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000330	526	827	PF00176	SNF2-related
HMMPfam	IPR001650	1141	1219	PF00271	DNA/RNA helicase
HMMSmart	IPR014001	519	717	SM00487	DEAD-like helicases
HMMSmart	IPR001650	1136	1219	SM00490	DNA/RNA helicase
ProfileScan	IPR014021	535	706	PS51192	Helicase
ProfileScan	IPR001650	1110	1265	PS51194	DNA/RNA helicase

Primer_f	TGAGTCAGAAGTGGAAATGTC
Primer_r	TGGCTATACAGTTCACTTGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-