Order Kazusa clone(s) from : ![]() |
Product ID | ORK05665 |
---|---|
Accession No | AB040931 |
Description | E1A binding protein p400 |
Clone name | hh01611 |
Vector information | |
cDNA sequence | DNA sequence (5197 bp) Predicted protein sequence (1731 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1498
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 0 bp |
---|---|
Genome contig ID | gi89161190f_130911113 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (169141 - 169190) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | f | 131011113 | 131080252 | 26 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR006562 | 765 | 836 | PF07529 | HSA |
IPR000330 | 1059 | 1339 | PF00176 | SNF2-related | |
HMMSmart | IPR013999 | 765 | 836 | SM00573 | HAS subgroup |
IPR014001 | 1052 | 1241 | SM00487 | DEAD-like helicases | |
ProfileScan | IPR014012 | 764 | 836 | PS51204 | Helicase/SANT-associated |
IPR014021 | 1068 | 1233 | PS51192 | Helicase |
![]() |
Primer_f | CCGCATCTCTAATCCTGAAGG |
---|---|
Primer_r | ACTGCACAGGCTGAAACAACC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCGCATCTCTAATCCTGAAGG |
Primer_r | ACTGCACAGGCTGAAACAACC |
PCR product length | 231(2k) bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |