KIAA1498

Product ID	ORK05665
Accession No	AB040931
Description	E1A binding protein p400
Clone name	hh01611
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5197 bp) Predicted protein sequence (1731 aa)
Source	Human adult brain
Rouge ID	mKIAA1498 by Kazusa Mouse cDNA Project

Length: 5197 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	0 bp
Genome contig ID	gi89161190f_130911113
PolyA signal sequence (None)	+--------+--------+----*----+---- CCGGTGGTGGCAGCACCCCCGTCCCTACGGGTGCC
Flanking genome sequence (169141 - 169190)	----+--------+--------+--------+--------+----* GCGGCCGCCACCCCTGTACAGCCACAGAATGAGGATCTTGAGGCAGGGCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	131011113	131080252	26	100.0	Perfect prediction

Length: 1731 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI50292	100.0	EP400 protein [...	Homo sapiens
BAG10081	100.0	E1A binding pro...	synthetic construct
AAK97789	95.4	p400 SWI2/SNF2-...	Homo sapiens
EAW98536	95.5	E1A binding pro...	Homo sapiens
NP_056224	95.4	E1A binding pro...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002307	6e-33	35.0	KIAA0309
AB033085	1.6e-08	27.3	KIAA1259
AB032948	9.4e-07	26.8	KIAA1122
AB046784	4.1e-06	23.9	KIAA1564
AB002306	0.00061	30.3	KIAA0308

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006562	765	836	PF07529	HSA
HMMPfam	IPR000330	1059	1339	PF00176	SNF2-related
HMMSmart	IPR013999	765	836	SM00573	HAS subgroup
HMMSmart	IPR014001	1052	1241	SM00487	DEAD-like helicases
ProfileScan	IPR014012	764	836	PS51204	Helicase/SANT-associated
ProfileScan	IPR014021	1068	1233	PS51192	Helicase

Primer_f	CCGCATCTCTAATCCTGAAGG
Primer_r	ACTGCACAGGCTGAAACAACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCGCATCTCTAATCCTGAAGG
Primer_r	ACTGCACAGGCTGAAACAACC
PCR product length	231(2k) bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles