KIAA1335

Product ID	ORK04549
Accession No	AB037756
Description	chromodomain helicase DNA binding protein 6
Clone name	bf00973
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (8116 bp) Predicted protein sequence (2041 aa)
Source	Human adult brain
Rouge ID	mKIAA1335 by Kazusa Mouse cDNA Project
Note	We replaced fh16079, former representative clones for KIAA1335 with bf00973. (2002/5/10)

Length: 8116 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1989 bp
Genome contig ID	gi51511747r_39364658
PolyA signal sequence (AATACA,-14)	+--------+--------+----*----+---- GTATTTGCCCTAAATCCTTAAAATACAAATGCTAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAATTCCTGTATCTTGAAAGCCTTACTGCAAATGAGTATTATAGACAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	39464658	39546641	23	99.6	Perfect prediction

Length: 2041 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI22255	100.0	chromodomain he...	Homo sapiens
EAW75976	100.0	chromodomain he...	Homo sapiens
Q8TD26	100.0	Chromodomain-he...	Homo sapiens
AAK56405	99.9	chromodomain he...	Homo sapiens
XP_001147951	99.8	chromodomain he...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046784	8.8e-164	65.4	KIAA1564
AB037837	1.2e-139	47.8	KIAA1416
AB002306	7.5e-129	43.7	KIAA0308
AB007913	1.2e-22	30.4	KIAA0444
AB033085	4.2e-15	36.9	KIAA1259

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000330	1	77	PF00176	SNF2-related
	IPR001650	144	223	PF00271	DNA/RNA helicase
	IPR006576	1728	1768	PF07533	BRK
HMMSmart	IPR001650	139	223	SM00490	DNA/RNA helicase
HMMSmart	IPR006576	1728	1768	SM00592	BRK
ProfileScan	IPR001650	113	282	PS51194	DNA/RNA helicase

Primer_f	TGAGAAAGAACCTGCCTAAGC
Primer_r	GCAACATTTCCAAGGGTCCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-