Gene/Protein Characteristic Table for KIAA1444
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06323
Accession No AB040877
Description PDZ domain containing 4
Clone name fg03469a
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (1248 bp)
Predicted protein sequence (416 aa)
Source Human fetal brain
Features of the cloned cDNA sequence
Description

Length: 1248 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 0 bp
Genome contig ID gi89161218r_152622671
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CCGGCCGGAGGCAGCACGCGGAGGAGCGCGGCCGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CGCAACCCCAAGACGGGGTTGACCCTGGAGCGTGTGGGCCCTGAAAGCAG
Features of the protein sequence
Description

Length: 416 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW72798 9.2e-149 100.0 hCG2004980, iso...
Homo sapiens
AAI43460 9.2e-149 100.0 Unknown (protei...
Homo sapiens
EAW72791 9.4e-149 100.0 hCG2004980, iso...
Homo sapiens
EAW72802 9.6e-149 100.0 hCG2004980, iso...
Homo sapiens
Q76G19 1e-148 100.0 PDZ domain-cont...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB029018 4.2e-42 49.9 KIAA1095
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001478 1 81 PF00595 PDZ/DHR/GLGF
HMMSmart IPR001478 9 84 SM00228 PDZ/DHR/GLGF
ProfileScan IPR001478 1 68 PS50106 PDZ/DHR/GLGF
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TGTATAAAAGCAGCCACCGGG
Primer_r ACCTCTCCGACATAAATGCCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. X
Experimental conditions
Panel name GeneBridge 4
Primer_f TGTATAAAAGCAGCCACCGGG
Primer_r ACCTCTCCGACATAAATGCCC
PCR product length 91 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp