Order Kazusa clone(s) from : ![]() |
Product ID | ORK01176 |
---|---|
Accession No | AB051462 |
Description | PR domain containing 16, transcript variant 1 |
Clone name | ae00102 |
Vector information | |
cDNA sequence | DNA sequence (8671 bp) Predicted protein sequence (1286 aa) |
Flexi ORF Clone | FXC01176 |
Source | Human brain (amygdala) |
Rouge ID |
mKIAA1675
by Kazusa Mouse cDNA Project
|
Note | We replaced fg05423, former representative clones for KIAA1675 with ae00102. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 4808 bp |
---|---|
Genome contig ID | gi89161185f_2875652 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (469393 - 469442) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 2975652 | 3345043 | 17 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 319 | 338 | PD000003 | Zinc finger |
IPR007087 | 376 | 399 | PD000003 | Zinc finger | |
IPR007087 | 961 | 984 | PD000003 | Zinc finger | |
IPR007087 | 989 | 1012 | PD000003 | Zinc finger | |
HMMPfam | IPR007087 | 240 | 263 | PF00096 | Zinc finger |
IPR007087 | 291 | 313 | PF00096 | Zinc finger | |
IPR007087 | 319 | 341 | PF00096 | Zinc finger | |
IPR007087 | 347 | 370 | PF00096 | Zinc finger | |
IPR007087 | 376 | 398 | PF00096 | Zinc finger | |
IPR007087 | 404 | 426 | PF00096 | Zinc finger | |
IPR007087 | 433 | 455 | PF00096 | Zinc finger | |
IPR007087 | 961 | 983 | PF00096 | Zinc finger | |
IPR007087 | 989 | 1012 | PF00096 | Zinc finger | |
IPR007087 | 1018 | 1040 | PF00096 | Zinc finger | |
HMMSmart | IPR001214 | 94 | 227 | SM00317 | SET |
IPR015880 | 240 | 260 | SM00355 | Zinc finger | |
IPR015880 | 291 | 313 | SM00355 | Zinc finger | |
IPR015880 | 319 | 341 | SM00355 | Zinc finger | |
IPR015880 | 347 | 370 | SM00355 | Zinc finger | |
IPR015880 | 376 | 398 | SM00355 | Zinc finger | |
IPR015880 | 404 | 426 | SM00355 | Zinc finger | |
IPR015880 | 433 | 460 | SM00355 | Zinc finger | |
IPR015880 | 961 | 983 | SM00355 | Zinc finger | |
IPR015880 | 989 | 1012 | SM00355 | Zinc finger | |
IPR015880 | 1018 | 1040 | SM00355 | Zinc finger | |
ProfileScan | IPR001214 | 93 | 225 | PS50280 | SET |
IPR007087 | 240 | 267 | PS50157 | Zinc finger | |
IPR007087 | 291 | 318 | PS50157 | Zinc finger | |
IPR007087 | 319 | 346 | PS50157 | Zinc finger | |
IPR007087 | 347 | 375 | PS50157 | Zinc finger | |
IPR007087 | 376 | 403 | PS50157 | Zinc finger | |
IPR007087 | 404 | 431 | PS50157 | Zinc finger | |
IPR007087 | 433 | 460 | PS50157 | Zinc finger | |
IPR007087 | 961 | 988 | PS50157 | Zinc finger | |
IPR007087 | 989 | 1017 | PS50157 | Zinc finger | |
IPR007087 | 1018 | 1045 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 293 | 313 | PS00028 | Zinc finger |
IPR007087 | 321 | 341 | PS00028 | Zinc finger | |
IPR007087 | 349 | 370 | PS00028 | Zinc finger | |
IPR007087 | 378 | 398 | PS00028 | Zinc finger | |
IPR007087 | 406 | 426 | PS00028 | Zinc finger | |
IPR007087 | 963 | 983 | PS00028 | Zinc finger | |
IPR007087 | 991 | 1012 | PS00028 | Zinc finger | |
IPR007087 | 1020 | 1042 | PS00028 | Zinc finger |
![]() |
Primer_f | TTAATACGGAAATCGCTGTGG |
---|---|
Primer_r | TAACCTCCAAATCGGCTTCTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTCTTATTGCGCCAGGGTGAC |
Primer_r | GGTGAAAAGTATAGGGTAGGC |
PCR product length | 147 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |