KIAA1705

Product ID	ORK04721
Accession No	AB051492
Description	DDHD domain containing 1
Clone name	fj17028
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3949 bp) Predicted protein sequence (498 aa)
Source	Human fetal brain
Rouge ID	mKIAA1705 by Kazusa Mouse cDNA Project

Length: 3949 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	739 bp
Genome contig ID	gi51511730r_52482495
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- ATACATTTTTTTTCATTAAAAACTTATGGCTTCAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACAACACTAGTTCAATTTTTTAAATAAACTTTTTATTATGTTACATGTAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	52582495	52630132	9	99.2	Perfect prediction

Length: 498 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_509953	5.3e-201	99.8	DDHD domain con...	Pan troglodytes
EAW80622	5.9e-201	99.8	DDHD domain con...	Homo sapiens
XP_001160034	6e-201	99.8	DDHD domain con...	Pan troglodytes
EAW80623	6e-201	99.8	DDHD domain con...	Homo sapiens
XP_001159988	6e-201	99.8	DDHD domain con...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018268	2.4e-10	27.8	KIAA0725
AB040890	1.3e-05	22.8	KIAA1457

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004177	237	484	PF02862	DDHD
ProfileScan	IPR004177	237	484	PS51043	DDHD

Primer_f	AGAGAATCAAGCAAGACCTGG
Primer_r	AGAATATGCTGAACCTTGACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-