Order Kazusa clone(s) from : ![]() |
Product ID | ORK00919 |
---|---|
Accession No | AB058690 |
Description | neuralized E3 ubiquitin protein ligase 4, transcript variant 1 |
Clone name | fh19054 |
Vector information | |
cDNA sequence | DNA sequence (5185 bp) Predicted protein sequence (1564 aa) |
HaloTag ORF Clone |
FHC00919
![]() |
Flexi ORF Clone | FXC00919 |
Source | Human fetal brain |
Rouge ID |
mKIAA1787
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 489 bp |
---|---|
Genome contig ID | gi51511734r_7059677 |
PolyA signal sequence (AATAAA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | r | 7159677 | 7173362 | 29 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR006573 | 46 | 113 | PF07177 | NEUZ |
IPR006573 | 319 | 389 | PF07177 | NEUZ | |
IPR006573 | 522 | 592 | PF07177 | NEUZ | |
IPR006573 | 718 | 788 | PF07177 | NEUZ | |
IPR006573 | 917 | 982 | PF07177 | NEUZ | |
IPR006573 | 1133 | 1200 | PF07177 | NEUZ | |
HMMSmart | IPR006573 | 47 | 165 | SM00588 | NEUZ |
IPR006573 | 317 | 442 | SM00588 | NEUZ | |
IPR006573 | 520 | 644 | SM00588 | NEUZ | |
IPR006573 | 716 | 840 | SM00588 | NEUZ | |
IPR006573 | 913 | 1044 | SM00588 | NEUZ | |
IPR006573 | 1131 | 1251 | SM00588 | NEUZ | |
ProfileScan | IPR006573 | 43 | 209 | PS51065 | NEUZ |
IPR006573 | 319 | 486 | PS51065 | NEUZ | |
IPR006573 | 522 | 688 | PS51065 | NEUZ | |
IPR006573 | 718 | 886 | PS51065 | NEUZ | |
IPR006573 | 915 | 1088 | PS51065 | NEUZ | |
IPR006573 | 1133 | 1296 | PS51065 | NEUZ |
![]() |
Primer_f | AAGATTATTTCATGCCTCCGC |
---|---|
Primer_r | TATGCCATGTGCCACTTCTTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |