KIAA1788

Product ID	ORK01180
Accession No	AB058691
Description	ALX homeobox 4
Clone name	fh22801
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5654 bp) Predicted protein sequence (413 aa)
HaloTag ORF Clone	FHC01180
Flexi ORF Clone	FXC01180
Source	Human fetal brain

Length: 5654 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4411 bp
Genome contig ID	gi51511727r_44138570
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GTTGTTATTTGCAATAAACTCCTTCTCCTTCCTCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TCTCAACTGGAATCTGTCTGTTTTGTTCCTGACTTGTGACAGATGAAATG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	44238570	44288195	4	99.1	Perfect prediction

Length: 413 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAC15120	3.4e-124	100.0	homeodomain tra...	Homo sapiens
AAK38835	8e-124	99.8	aristaless-like...	Homo sapiens
EAW68066	1.1e-123	99.8	aristaless-like...	Homo sapiens
Q9H161	2.6e-123	99.5	Homeobox protei...	Homo sapiens
XP_001113643	6e-122	98.5	similar to aris...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001356	216	273	PD000010	Homeobox
FPrintScan	IPR001356	253	263	PR00024	Homeobox
FPrintScan	IPR001356	263	272	PR00024	Homeobox
HMMPfam	IPR001356	217	273	PF00046	Homeobox
HMMPfam	IPR003654	388	408	PF03826	Paired-like homeodomain protein
HMMSmart	IPR001356	216	278	SM00389	Homeobox
ProfileScan	IPR001356	214	274	PS50071	Homeobox
ProfileScan	IPR003654	393	406	PS50803	Paired-like homeodomain protein
ScanRegExp	IPR001356	249	272	PS00027	Homeobox

Primer_f	AATAGCACTTGGAGGACATGG
Primer_r	CGCAGTGTCTTTGAGCTAACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	AATAGCACTTGGAGGACATGG
Primer_r	CGCAGTGTCTTTGAGCTAACC
PCR product length	131 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles