KIAA1791

Product ID	ORK04501
Accession No	AB058694
Description	cyclin-dependent kinase 13
Clone name	fh26241
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4803 bp) Predicted protein sequence (653 aa)
Source	Human fetal brain
Rouge ID	mKIAA1791 by Kazusa Mouse cDNA Project

Length: 4803 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	566 bp
Genome contig ID	gi89161213f_39965786
PolyA signal sequence (None)	+--------+--------+----*----+---- AAAACACAACCTTTCTCTTGATGCAACAGTTTTAT
Flanking genome sequence (135886 - 135935)	----+--------+--------+--------+--------+----* AAAAAAAAAAATGGTCAACGTTATTTTTGTTTTGTTTTGCAGATTATCAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	40065786	40101670	8	99.3	Perfect prediction

Length: 653 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q14004	0	99.4	Cell division c...	Homo sapiens
CAC10400	0	99.2	CDC2L5 protein ...	Homo sapiens
XP_001139939	0	99.2	cell division c...	Pan troglodytes
XP_001915656	6.6e-216	97.2	similar to cell...	Equus caballus
XP_533082	6.7e-213	95.9	similar to Cell...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020711	4.9e-36	44.0	KIAA0904
AB020641	3.4e-05	34.3	KIAA0834
AB023153	0.00015	26.2	KIAA0936

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	9	130	PD000001	Protein kinase
HMMPfam	IPR000719	8	139	PF00069	Protein kinase
HMMSmart	IPR002290	1	139	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	1	139	PS50011	Protein kinase

Primer_f	GTACTGCTTCATCTCATTCTG
Primer_r	CAGGACTGCAATAGGACCATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-