Order Kazusa clone(s) from : ![]() |
Product ID | ORK00922 |
---|---|
Accession No | AB058705 |
Description | chromosome alignment maintaining phosphoprotein 1, transcript variant 1 |
Clone name | fj21631 |
Vector information | |
cDNA sequence | DNA sequence (3555 bp) Predicted protein sequence (821 aa) |
HaloTag ORF Clone |
FHC00922
![]() |
Flexi ORF Clone | FXC00922 |
Source | Human fetal brain |
Rouge ID |
mKIAA1802
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1040 bp |
---|---|
Genome contig ID | gi51511729f_114007344 |
PolyA signal sequence (ATTAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (103556 - 103605) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 13 | f | 114107344 | 114110898 | 1 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | NULL | 152 | 168 | PR01217 | NULL |
NULL | 185 | 197 | PR01217 | NULL | |
NULL | 203 | 224 | PR01217 | NULL | |
NULL | 232 | 248 | PR01217 | NULL | |
NULL | 253 | 270 | PR01217 | NULL | |
HMMPfam | IPR007087 | 747 | 769 | PF00096 | Zinc finger |
HMMSmart | IPR015880 | 23 | 46 | SM00355 | Zinc finger |
IPR015880 | 71 | 94 | SM00355 | Zinc finger | |
IPR015880 | 718 | 741 | SM00355 | Zinc finger | |
IPR015880 | 747 | 769 | SM00355 | Zinc finger | |
IPR015880 | 774 | 795 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 747 | 769 | PS50157 | Zinc finger |
ScanRegExp | IPR007087 | 749 | 769 | PS00028 | Zinc finger |
![]() |
Primer_f | AATAGTTTGCAGCCTTCTCCC |
---|---|
Primer_r | AAGATACAGAATGGAAGACTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |