Order Kazusa clone(s) from : ![]() |
Product ID | ORK00957 |
---|---|
Accession No | AB075840 |
Description | shroom family member 1, transcript variant 1 |
Clone name | hk03842 |
Vector information | |
cDNA sequence | DNA sequence (4017 bp) Predicted protein sequence (871 aa) |
HaloTag ORF Clone |
FHC00957
![]() |
Flexi ORF Clone | FXC00957 |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 653 bp |
---|---|
Genome contig ID | gi51511721r_132085734 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | r | 132185734 | 132194489 | 10 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TCTATGTGACCCTCTTGCTTC |
---|---|
Primer_r | GGGTGAAGCTGAACTGATAGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |