KIAA1960

Product ID	ORK00957
Accession No	AB075840
Description	shroom family member 1, transcript variant 1
Clone name	hk03842
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hk03842 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCGG ACGCGTGGG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (4017 bp) Predicted protein sequence (871 aa)
HaloTag ORF Clone	FHC00957
Flexi ORF Clone	FXC00957
Source	Human adult brain

Length: 4017 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	653 bp
Genome contig ID	gi51511721r_132085734
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CAGCCTATTTTTTCTTCAATAAAAATTGTTAAGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGTGTGTGTGTCATCTGCAGCACAGCTGTGGGAGGAGTGAGAGGGGTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	132185734	132194489	10	100.0	Perfect prediction

Length: 871 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_527007	98.4	apical protein ...	Pan troglodytes
Q2M3G4	100.0	Protein Shroom1...	Homo sapiens
EAW62311	99.4	apical protein ...	Homo sapiens
AAM15526	99.3	apical protein ...	Homo sapiens
XP_001100079	92.4	similar to apic...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040914	4.7e-08	23.3	KIAA1481
AB033028	2.1e-06	30.4	KIAA1202

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014800	126	292	PF08688	Apx/shroom
HMMPfam	IPR014799	566	843	PF08687	Apx/shroom

Primer_f	TCTATGTGACCCTCTTGCTTC
Primer_r	GGGTGAAGCTGAACTGATAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-