KIAA1481

Product ID	ORK06827
Accession No	AB040914
Description	shroom family member 3
Clone name	fj05724
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4755 bp) Predicted protein sequence (1380 aa)
Source	Human fetal brain
Rouge ID	mKIAA1481 by Kazusa Mouse cDNA Project

Length: 4755 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	612 bp
Genome contig ID	gi89161207f_77780199
PolyA signal sequence (AATGAA,-16)	+--------+--------+----*----+---- TTTGTGAAAACCTTAATGAAATGAATTCCAAAGAT
Flanking genome sequence (139769 - 139818)	----+--------+--------+--------+--------+----* AGTCACGTTGAGCGTGAAGACTTTTTTTCTTACATTCCTGTCTTATTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	77880199	77919966	7	99.8	Perfect prediction

Length: 1380 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8TF72	100.0	Protein Shroom3...	Homo sapiens
EAX05795	100.0	shroom, isoform...	Homo sapiens
BAG54709	99.9	unnamed protein...	Homo sapiens
AAI56133	99.9	Shroom family m...	synthetic construct
NP_065910	99.9	shroom family m...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033028	3.8e-15	25.6	KIAA1202
AB075840	3.4e-06	23.4	KIAA1960

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014800	267	450	PF08688	Apx/shroom
HMMPfam	IPR014799	1057	1340	PF08687	Apx/shroom

Primer_f	GGATGTTCATAGGGGATTTGG
Primer_r	TTCACCAAGGCCGCTAAGGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	GGATGTTCATAGGGGATTTGG
Primer_r	TTCACCAAGGCCGCTAAGGAC
PCR product length	98 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles