Gene/Protein Characteristic Table for KIAA1481
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06827
Accession No AB040914
Description shroom family member 3
Clone name fj05724
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4755 bp)
Predicted protein sequence (1380 aa)
Source Human fetal brain
Rouge ID mKIAA1481 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4755 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 612 bp
Genome contig ID gi89161207f_77780199
PolyA signal sequence
(AATGAA,-16)
+----*----+----*----+----*----+----
TTTGTGAAAACCTTAATGAAATGAATTCCAAAGAT
Flanking genome sequence
(139769 - 139818)
----+----*----+----*----+----*----+----*----+----*
AGTCACGTTGAGCGTGAAGACTTTTTTTCTTACATTCCTGTCTTATTTTT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 4 f 77880199 77919966 7 99.8 Perfect prediction
Features of the protein sequence
Description

Length: 1380 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8TF72 0 100.0 Protein Shroom3...
Homo sapiens
EAX05795 0 100.0 shroom, isoform...
Homo sapiens
BAG54709 0 99.9 unnamed protein...
Homo sapiens
AAI56133 0 99.9 Shroom family m...
synthetic construct
NP_065910 0 99.9 shroom family m...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB033028 3.8e-15 25.6 KIAA1202
AB075840 3.4e-06 23.4 KIAA1960
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR014800 267 450 PF08688 Apx/shroom
IPR014799 1057 1340 PF08687 Apx/shroom
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GGATGTTCATAGGGGATTTGG
Primer_r TTCACCAAGGCCGCTAAGGAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 4
Experimental conditions
Panel name CCR
Primer_f GGATGTTCATAGGGGATTTGG
Primer_r TTCACCAAGGCCGCTAAGGAC
PCR product length 98 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp