KIAA0314

Product ID	ORK04254
Accession No	AB002312
Description	bromodomain adjacent to zinc finger domain, 2A
Clone name	af02425
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7440 bp) Predicted protein sequence (1899 aa)
Source	Human brain (amygdala)
Rouge ID	mKIAA0314 by Kazusa Mouse cDNA Project
Note	We replaced hg00235, former representative clones for KIAA0314 with af02425. (2005/08/06)

Length: 7440 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1739 bp
Genome contig ID	gi89161190r_55176005
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TCAGTTGTTGAATAAAAAAACCACATTTGATAGAG
Flanking genome sequence (99977 - 99928)	----+--------+--------+--------+--------+----* ATTCAAAAGACTCTGTGTATTCATCTTCCCTTCTACACACCTGAGGGGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	55275982	55297570	29	99.5	Perfect prediction

Length: 1899 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI52740	100.0	Bromodomain adj...	synthetic construct
CAH18232	99.8	hypothetical pr...	Homo sapiens
XP_509537	99.6	bromodomain adj...	Pan troglodytes
XP_001115300	98.3	bromodomain adj...	Macaca mulatta
XP_001504899	92.4	similar to Brom...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040909	3e-17	36.5	KIAA1476

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000637	1180	1190	PR00929	HMG-I and HMG-Y
	IPR000637	1349	1360	PR00929	HMG-I and HMG-Y
	IPR000637	1396	1406	PR00929	HMG-I and HMG-Y
	IPR001487	1807	1820	PR00503	Bromodomain
	IPR001487	1821	1837	PR00503	Bromodomain
	IPR001487	1837	1855	PR00503	Bromodomain
	IPR001487	1855	1874	PR00503	Bromodomain
HMMPfam	IPR001739	540	614	PF01429	Methyl-CpG binding
	IPR000637	643	655	PF02178	HMG-I and HMG-Y
	IPR000637	664	676	PF02178	HMG-I and HMG-Y
	IPR004022	843	904	PF02791	DDT
	IPR000637	1180	1192	PF02178	HMG-I and HMG-Y
	IPR000637	1398	1410	PF02178	HMG-I and HMG-Y
	IPR001965	1672	1720	PF00628	Zinc finger
	IPR001487	1795	1879	PF00439	Bromodomain
HMMSmart	IPR001739	543	618	SM00391	Methyl-CpG binding
	IPR000637	643	655	SM00384	HMG-I and HMG-Y
	IPR000637	664	676	SM00384	HMG-I and HMG-Y
	IPR004022	842	907	SM00571	DDT
	IPR000637	1180	1192	SM00384	HMG-I and HMG-Y
	IPR000637	1398	1410	SM00384	HMG-I and HMG-Y
	IPR001965	1672	1718	SM00249	Zinc finger
	IPR001487	1785	1893	SM00297	Bromodomain
ProfileScan	IPR001739	540	611	PS50982	Methyl-CpG binding
	IPR004022	842	907	PS50827	DDT
	IPR001965	1670	1720	PS50016	Zinc finger
	IPR001487	1804	1874	PS50014	Bromodomain
ScanRegExp	IPR001487	1809	1866	PS00633	Bromodomain

Primer_f	ACAGACAACCGCCCCCTAAAG
Primer_r	TCTGCCTCATCTTCTTCTTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ACAGACAACCGCCCCCTAAAG
Primer_r	TCTGCCTCATCTTCTTCTTGC
PCR product length	97 (2.5k) bp
PCR conditions	95 °C15 sec64 °C120 sec30 cycles