KIAA1782

Product ID	ORK05504
Accession No	AB058685
Description	IKAROS family zinc finger 4 (Eos)
Clone name	aj00273
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4396 bp) Predicted protein sequence (545 aa)
Source	Human brain (amygdala)

Length: 4396 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2505 bp
Genome contig ID	gi89161190f_54604791
PolyA signal sequence (None)	+--------+--------+----*----+---- AACATCCTCATGCTCTCTCCCAGCTCCTTTTGCAT
Flanking genome sequence (113098 - 113147)	----+--------+--------+--------+--------+----* AAAAAAAAAAGTAAAGAAAAAGAAAAAAAAATACACACACACTGAAACCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	54704791	54717887	6	100.0	Perfect prediction

Length: 545 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW96872	7.3e-201	100.0	zinc finger pro...	Homo sapiens
BAG10493	3.8e-194	99.4	zinc finger pro...	synthetic construct
Q9H2S9	1.3e-193	96.9	Zinc finger pro...	Homo sapiens
EAW96874	1.5e-193	99.6	zinc finger pro...	Homo sapiens
XP_001113514	5.1e-193	96.7	similar to zinc...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058755	2.3e-07	31.0	KIAA1852
AB058709	2.7e-07	30.2	KIAA1806
AB023232	2.9e-07	32.4	KIAA1015
AB095924	3.3e-07	41.1	KIAA2003
D31763	3.4e-07	24.1	KIAA0065

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	147	169	PF00096	Zinc finger
	IPR007087	175	197	PF00096	Zinc finger
	IPR007087	208	231	PF00096	Zinc finger
HMMSmart	IPR015880	119	141	SM00355	Zinc finger
	IPR015880	147	169	SM00355	Zinc finger
	IPR015880	175	197	SM00355	Zinc finger
	IPR015880	208	231	SM00355	Zinc finger
	IPR015880	490	512	SM00355	Zinc finger
	IPR015880	518	542	SM00355	Zinc finger
ProfileScan	IPR007087	119	146	PS50157	Zinc finger
	IPR007087	147	174	PS50157	Zinc finger
	IPR007087	175	202	PS50157	Zinc finger
	IPR007087	208	236	PS50157	Zinc finger
ScanRegExp	IPR007087	121	141	PS00028	Zinc finger
	IPR007087	149	169	PS00028	Zinc finger
	IPR007087	177	197	PS00028	Zinc finger
	IPR007087	210	231	PS00028	Zinc finger
	IPR007087	492	512	PS00028	Zinc finger

Primer_f	GTCAACTGTGGCACCTGTAAC
Primer_r	GGTTAAAGTGCAGTGATGGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-