|
Order Kazusa clone(s) from : |
| Product ID | ORK01029 |
|---|---|
| Accession No | AK000002 |
| Clone name | as00002 |
| Vector information | |
| cDNA sequence | DNA sequence (5023 bp) Predicted protein sequence (1513 aa) |
|
HaloTag ORF Clone |
FHC01029
|
| Flexi ORF Clone | FXC01029 |
| Source | Human spleen |
| Rouge ID |
mFLJ00002
by Kazusa Mouse cDNA Project
|
Length: 5023 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Length: 1513 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR001140 | 306 | 572 | PF00664 | ABC transporter |
| IPR003439 | 647 | 821 | PF00005 | ABC transporter | |
| IPR001140 | 906 | 1219 | PF00664 | ABC transporter | |
| IPR003439 | 1294 | 1476 | PF00005 | ABC transporter | |
| HMMSmart | IPR003593 | 646 | 830 | SM00382 | AAA ATPase |
| IPR003593 | 1293 | 1477 | SM00382 | AAA ATPase | |
| ProfileScan | NULL | 53 | 454 | PS50319 | NULL |
| IPR001687 | 649 | 671 | PS50101 | ATP/GTP-binding site motif A (P-loop) | |
| IPR003439 | 747 | 818 | PS50100 | ABC transporter | |
| IPR001687 | 1296 | 1321 | PS50101 | ATP/GTP-binding site motif A (P-loop) | |
| IPR003439 | 1403 | 1473 | PS50100 | ABC transporter | |
| ScanRegExp | IPR003439 | 747 | 761 | PS00211 | ABC transporter |
| IPR003439 | 1403 | 1417 | PS00211 | ABC transporter |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 49 | CFTQLVLSALPHALLAVLSACYL | 71 | SECONDARY | 23 | 2 | 90 | RLAASFLLSVFPLLDLLPVALPP | 112 | PRIMARY | 23 | 3 | 121 | LEVLAGCVAAVAWISHSLALWVL | 143 | PRIMARY | 23 | 4 | 155 | LALALVALLPAPALVLTVLWHCQ | 177 | PRIMARY | 23 | 5 | 191 | ARLCLLILQLAALLAYALGWAAP | 213 | PRIMARY | 23 | 6 | 309 | LGLLKLVGTMLGFSGPLLLSLLV | 331 | PRIMARY | 23 | 7 | 341 | LSHGLLYALGLAGGAVLGAVLQN | 363 | SECONDARY | 23 | 8 | 437 | YQQVGVAFVGGLILALLLVPVNK | 459 | PRIMARY | 23 | 9 | 525 | AACVYLWAALPVVISIVIFITYV | 547 | PRIMARY | 23 | 10 | 562 | LALVRMLILPLNNFPWVINGLLE | 584 | SECONDARY | 23 | 11 | 900 | AVGQGLALAILFSLLLMQATRNA | 922 | PRIMARY | 23 | 12 | 949 | PASMGLFSPQLLLFSPGNLYIPV | 971 | SECONDARY | 23 | 13 | 987 | FYLTVYATIAGVNSLCTLLRAVL | 1009 | PRIMARY | 23 | 14 | 1070 | NAAGLLGLLAVLGSGLPWLLLLL | 1092 | PRIMARY | 23 | 15 | 1175 | RLQLMGAAVVSAIAGIALVQHQ | 1196 | SECONDARY | 22 |
|---|
RT-PCR-ELISA
|
Experimental conditions| Primer_f | GGCTGCTTGTTTACATTCTCC |
|---|---|
| Primer_r | TCCTATGCCAGAAAAACCCAC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |