Gene/Protein Characteristic Table for FLJ00030
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06250
Accession No AK024440
Clone name as00030
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4404 bp)
Predicted protein sequence (249 aa)
Source Human spleen
Features of the cloned cDNA sequence
Description

Length: 4404 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 249 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15730 5.6e-104 100.0 FLJ00030 protei...
Homo sapiens
BAG52651 2.6e-102 99.2 unnamed protein...
Homo sapiens
Q9BYC2 2.6e-102 99.2 Succinyl-CoA:3-...
Homo sapiens
BAG37161 7.7e-102 98.8 unnamed protein...
Homo sapiens
ABM84266 1.8e-100 99.2 3-oxoacid CoA t...
synthetic construct
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR004165 31 230 PF01144 Coenzyme A transferase
ScanRegExp IPR004164 70 78 PS01274 Coenzyme A transferase active site
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GCTTCCCCATAACCTTGACTC
Primer_r CAGTGAATCCAGAGACCAACC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp