FLJ00038

Product ID	ORK05043
Accession No	AK024448
Clone name	as00038
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4404 bp) Predicted protein sequence (199 aa)
Source	Human spleen

Length: 4404 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Length: 199 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB15738	1.5e-74	100.0	FLJ00038 protei...	Homo sapiens
XP_001714955	2.2e-13	94.9	similar to FLJ0...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)

No significant homologues

RT-PCR-ELISA

Experimental conditions

Primer_f	CAGGAAATGGTGACAGATAGG
Primer_r	AACCGTTTGCTGTATTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp