Gene/Protein Characteristic Table for FLJ00044
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01032
Accession No AK024452
Clone name as00044
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4340 bp)
Predicted protein sequence (1051 aa)
Flexi ORF Clone FXC01032
Source Human spleen
Rouge ID mFLJ00044 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4340 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1051 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15742 0 100.0 FLJ00044 protei...
Homo sapiens
XP_524448 0 99.3 zinc finger, SW...
Pan troglodytes
Q9H7M6 0 100.0 Zinc finger SWI...
Homo sapiens
EAW84373 0 99.9 zinc finger, SW...
Homo sapiens
XP_867133 0 96.6 similar to Zinc...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB040944 3.2e-98 56.9 KIAA1511
AB046797 8.8e-92 63.5 KIAA1577
AB020720 1.7e-15 36.4 KIAA0913
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000637 67 78 PR00929 HMG-I and HMG-Y DNA-binding domain (A+T-hook)
IPR000637 86 96 PR00929 HMG-I and HMG-Y DNA-binding domain (A+T-hook)
HMMPfam IPR007527 201 238 PF04434 SWIM Zn-finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CATCCAGCAGAACATCCACTC
Primer_r ATATTCATCAGGGCTTGCGGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp