Gene/Protein Characteristic Table for FLJ00060
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05754
Accession No AK024467
Clone name as00060
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4305 bp)
Predicted protein sequence (227 aa)
Source Human spleen
Features of the cloned cDNA sequence
Description

Length: 4305 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 227 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15757 5.3e-103 100.0 FLJ00060 protei...
Homo sapiens
Q9H7L2 2.8e-99 98.6 Putative killer...
Homo sapiens
EAW72255 2.9e-99 98.6 hypothetical ge...
Homo sapiens
ABB53378 1e-98 98.2 killer immunogl...
Homo sapiens
ABB53379 1.4e-81 94.8 killer immunogl...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AK090399 1.6e-18 39.8 FLJ00275
AB002362 1.2e-10 31.1 KIAA0364
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007110 128 188 PF00047 Immunoglobulin-like
ProfileScan IPR007110 115 186 PS50835 Immunoglobulin-like
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TATGCCCAGTTAAACCACCAG
Primer_r GCGTATTAATGCCCTTTGTGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp