Order Kazusa clone(s) from : ![]() |
Product ID | ORK00518 |
---|---|
Accession No | AB002362 |
Description | immunoglobulin superfamily, member 1, transcript variant 4 |
Clone name | hh00116 |
Vector information | |
cDNA sequence | DNA sequence (5413 bp) Predicted protein sequence (1437 aa) |
HaloTag ORF Clone |
FHC00518
![]() |
Flexi ORF Clone | FXC00518 |
Source | Human adult brain |
Rouge ID |
mKIAA0364
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 285 bp |
---|---|
Genome contig ID | gi89161218r_130135166 |
PolyA signal sequence (AATAAA,-29) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013151 | 437 | 495 | PF00047 | Immunoglobulin |
IPR013151 | 535 | 587 | PF00047 | Immunoglobulin | |
IPR013151 | 797 | 853 | PF00047 | Immunoglobulin | |
IPR013151 | 893 | 952 | PF00047 | Immunoglobulin | |
IPR013151 | 989 | 1045 | PF00047 | Immunoglobulin | |
IPR013151 | 1181 | 1237 | PF00047 | Immunoglobulin | |
HMMSmart | IPR003599 | 144 | 224 | SM00409 | Immunoglobulin subtype |
IPR003599 | 238 | 323 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 244 | 307 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 334 | 418 | SM00409 | Immunoglobulin subtype | |
IPR003599 | 429 | 516 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 435 | 500 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 527 | 600 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 533 | 592 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 789 | 874 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 795 | 858 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 885 | 970 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 891 | 959 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 981 | 1066 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 987 | 1051 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 1077 | 1162 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 1083 | 1146 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 1173 | 1258 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 1179 | 1242 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 1269 | 1348 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 1275 | 1334 | SM00408 | Immunoglobulin subtype 2 | |
ProfileScan | IPR007110 | 139 | 207 | PS50835 | Immunoglobulin-like |
IPR007110 | 422 | 493 | PS50835 | Immunoglobulin-like | |
IPR007110 | 520 | 585 | PS50835 | Immunoglobulin-like | |
IPR007110 | 878 | 970 | PS50835 | Immunoglobulin-like | |
IPR007110 | 974 | 1043 | PS50835 | Immunoglobulin-like | |
IPR007110 | 1166 | 1235 | PS50835 | Immunoglobulin-like |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 620 | EAIRLSLIMQLVALLLVVLWIR | 641 | PRIMARY | 22 | 2 | 662 | TMLFIVTALLCCGLCNGVLIEE | 683 | PRIMARY | 22 | 3 | 1363 | IVRSSLIVVVVVALGVVLAIEW | 1384 | PRIMARY | 22 |
---|
![]() |
---|
Primer_f | TACAGTGAGGAGTTACAGGGG |
---|---|
Primer_r | GCTGTTCCTTGGTCTCTAATC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TACAGTGAGGAGTTACAGGGG |
Primer_r | GCTGTTCCTTGGTCTCTAATC |
PCR product length | 119 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |