KIAA0578

Product ID	ORK00566
Accession No	AB011150
Description	neurexin 1
Clone name	bf00990
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (8114 bp) Predicted protein sequence (1542 aa)
Flexi ORF Clone	FXC00566
Source	Human adult brain
Rouge ID	mKIAA0578 by Kazusa Mouse cDNA Project
Note	We replaced hj00406, former representative clones for KIAA0578 with bf00990. (2002/5/10)

Length: 8114 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3440 bp
Genome contig ID	gi89161199r_49899148
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TAAGTAAACCTGTGATTAAATTCCAACACTATCAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATACTCGTTACTATTTGCCTAATTTCTTTGACTCTCACATTGTGTTATTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	49999148	51109098	19	99.2	Perfect prediction

Length: 1542 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI50248	100.0	NRXN1 protein [...	Homo sapiens
XP_001114208	99.9	similar to neur...	Macaca mulatta
NP_064648	99.1	neurexin I [Mus...	Mus musculus
AAA41704	98.1	non-processed n...	Rattus norvegicus
XP_001375403	97.6	similar to neur...	Monodelphis dom...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018286	0	76.4	KIAA0743
AB023138	2.9e-162	59.7	KIAA0921
AB020675	1e-22	23.6	KIAA0868
AB051550	1.5e-21	25.1	KIAA1763
AB051501	1.8e-10	25.2	KIAA1714

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012680	104	238	PF02210	Laminin G
	IPR012680	358	484	PF02210	Laminin G
	IPR012680	546	690	PF02210	Laminin G
	IPR006209	718	750	PF00008	EGF-like
	IPR012680	784	915	PF02210	Laminin G
	IPR012680	971	1099	PF02210	Laminin G
	IPR006209	1125	1157	PF00008	EGF-like
	IPR012680	1194	1343	PF02210	Laminin G
HMMSmart	IPR001791	96	238	SM00282	Laminin G
	IPR006210	262	302	SM00181	EGF
	IPR001791	350	484	SM00282	Laminin G
	IPR001791	538	690	SM00282	Laminin G
	IPR006210	717	751	SM00181	EGF
	IPR001791	776	915	SM00282	Laminin G
	IPR001791	963	1099	SM00282	Laminin G
	IPR006210	1124	1158	SM00181	EGF
	IPR001791	1186	1343	SM00282	Laminin G
	IPR003585	1487	1505	SM00294	Neurexin/syndecan/glycophorin C
ProfileScan	IPR001791	76	263	PS50025	Laminin G
	IPR000742	265	302	PS50026	EGF-like
	IPR001791	329	511	PS50025	Laminin G
	IPR001791	518	710	PS50025	Laminin G
	IPR000742	714	751	PS50026	EGF-like
	IPR001791	756	929	PS50025	Laminin G
	IPR001791	943	1118	PS50025	Laminin G
	IPR000742	1121	1158	PS50026	EGF-like
	IPR001791	1164	1362	PS50025	Laminin G
ScanRegExp	IPR000152	729	740	PS00010	Aspartic acid and asparagine hydroxylation site

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	53	QRGGCFLLCLSLLLLGCWAELGS	75	PRIMARY	23
SOSUI2	2	1465	TTGMVVGIVAAAALCILILLYA	1486	PRIMARY	22

Primer_f	AAGATCCAAACGTGCATACAG
Primer_r	TTGCTTCCATAACCTGCCCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AAGATCCAAACGTGCATACAG
Primer_r	TTGCTTCCATAACCTGCCCAC
PCR product length	240 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles