KIAA0756

Product ID	ORK01119
Accession No	AB018299
Description	neurofascin, transcript variant 4
Clone name	ff01911
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (9959 bp) Predicted protein sequence (1222 aa)
HaloTag ORF Clone	FHC01119
Flexi ORF Clone	FXC01119
Source	Human fetal brain
Rouge ID	mKIAA0756 by Kazusa Mouse cDNA Project
Note	We replaced hk04562 and fh00384, former representative clones for KIAA0756 with ff01911. (2002/5/10,2005/08/06)

Length: 9959 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	6290 bp
Genome contig ID	gi89161185f_203056423
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AACACTAAACGTATAATAAAAGTTGTTCAAAATGG
Flanking genome sequence (202151 - 202200)	----+--------+--------+--------+--------+----* ACTCTTGCCATGTGATTTGCTCATTTTCTTGATTTGTTCCTGTTGGTAGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	203156423	203258572	26	99.3	Perfect prediction

Length: 1222 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_514129	99.5	neurofascin [Pa...	Pan troglodytes
XP_001097065	96.7	similar to neur...	Macaca mulatta
XP_856076	95.8	similar to neur...	Canis lupus fam...
BAG10378	100.0	neurofascin pre...	synthetic construct
CAI14658	99.6	neurofascin hom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002341	1.5e-68	51.2	KIAA0343
AB040947	3.9e-34	26.1	KIAA1514
AB040929	2.1e-33	28.2	KIAA1496
AB032958	4.8e-23	23.9	KIAA1132
AB037776	2.7e-18	25.3	KIAA1355

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013098	88	183	PF07679	Immunoglobulin I-set
	IPR013151	202	262	PF00047	Immunoglobulin
	IPR013098	308	397	PF07679	Immunoglobulin I-set
	IPR013098	401	489	PF07679	Immunoglobulin I-set
	IPR013098	494	582	PF07679	Immunoglobulin I-set
	IPR013098	586	673	PF07679	Immunoglobulin I-set
	IPR003961	677	763	PF00041	Fibronectin
	IPR003961	776	862	PF00041	Fibronectin
	IPR003961	874	969	PF00041	Fibronectin
	IPR003961	981	1068	PF00041	Fibronectin
HMMSmart	IPR003599	95	184	SM00409	Immunoglobulin subtype
	IPR003598	101	172	SM00408	Immunoglobulin subtype 2
	IPR003599	194	281	SM00409	Immunoglobulin subtype
	IPR003598	200	267	SM00408	Immunoglobulin subtype 2
	IPR003599	317	398	SM00409	Immunoglobulin subtype
	IPR003598	323	387	SM00408	Immunoglobulin subtype 2
	IPR003599	407	490	SM00409	Immunoglobulin subtype
	IPR003598	413	479	SM00408	Immunoglobulin subtype 2
	IPR003599	501	583	SM00409	Immunoglobulin subtype
	IPR003598	507	572	SM00408	Immunoglobulin subtype 2
	IPR003599	592	674	SM00409	Immunoglobulin subtype
	IPR003598	598	663	SM00408	Immunoglobulin subtype 2
	IPR003961	677	760	SM00060	Fibronectin
	IPR003961	777	859	SM00060	Fibronectin
	IPR003961	875	966	SM00060	Fibronectin
	IPR003961	981	1065	SM00060	Fibronectin
ProfileScan	IPR007110	88	184	PS50835	Immunoglobulin-like
	IPR007110	190	277	PS50835	Immunoglobulin-like
	IPR007110	308	396	PS50835	Immunoglobulin-like
	IPR007110	401	488	PS50835	Immunoglobulin-like
	IPR007110	493	581	PS50835	Immunoglobulin-like
	IPR007110	585	667	PS50835	Immunoglobulin-like
	IPR003961	677	769	PS50853	Fibronectin
	IPR003961	776	869	PS50853	Fibronectin
	IPR003961	874	976	PS50853	Fibronectin
	IPR003961	981	1074	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1090	QGWFIGLMCAIALLVLILLIVCF	1112	PRIMARY	23

Primer_f	TGCACCCCAATACAGAACATC
Primer_r	TGAGAGCCCTAAGTGAAATTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGCACCCCAATACAGAACATC
Primer_r	TGAGAGCCCTAAGTGAAATTC
PCR product length	162 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles