Order Kazusa clone(s) from : ![]() |
Product ID | ORK01119 |
---|---|
Accession No | AB018299 |
Description | neurofascin, transcript variant 4 |
Clone name | ff01911 |
Vector information | |
cDNA sequence | DNA sequence (9959 bp) Predicted protein sequence (1222 aa) |
HaloTag ORF Clone |
FHC01119
![]() |
Flexi ORF Clone | FXC01119 |
Source | Human fetal brain |
Rouge ID |
mKIAA0756
by Kazusa Mouse cDNA Project
|
Note | We replaced hk04562 and fh00384, former representative clones for KIAA0756 with ff01911. (2002/5/10,2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 6290 bp |
---|---|
Genome contig ID | gi89161185f_203056423 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (202151 - 202200) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 203156423 | 203258572 | 26 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013098 | 88 | 183 | PF07679 | Immunoglobulin I-set |
IPR013151 | 202 | 262 | PF00047 | Immunoglobulin | |
IPR013098 | 308 | 397 | PF07679 | Immunoglobulin I-set | |
IPR013098 | 401 | 489 | PF07679 | Immunoglobulin I-set | |
IPR013098 | 494 | 582 | PF07679 | Immunoglobulin I-set | |
IPR013098 | 586 | 673 | PF07679 | Immunoglobulin I-set | |
IPR003961 | 677 | 763 | PF00041 | Fibronectin | |
IPR003961 | 776 | 862 | PF00041 | Fibronectin | |
IPR003961 | 874 | 969 | PF00041 | Fibronectin | |
IPR003961 | 981 | 1068 | PF00041 | Fibronectin | |
HMMSmart | IPR003599 | 95 | 184 | SM00409 | Immunoglobulin subtype |
IPR003598 | 101 | 172 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 194 | 281 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 200 | 267 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 317 | 398 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 323 | 387 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 407 | 490 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 413 | 479 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 501 | 583 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 507 | 572 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 592 | 674 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 598 | 663 | SM00408 | Immunoglobulin subtype 2 | |
IPR003961 | 677 | 760 | SM00060 | Fibronectin | |
IPR003961 | 777 | 859 | SM00060 | Fibronectin | |
IPR003961 | 875 | 966 | SM00060 | Fibronectin | |
IPR003961 | 981 | 1065 | SM00060 | Fibronectin | |
ProfileScan | IPR007110 | 88 | 184 | PS50835 | Immunoglobulin-like |
IPR007110 | 190 | 277 | PS50835 | Immunoglobulin-like | |
IPR007110 | 308 | 396 | PS50835 | Immunoglobulin-like | |
IPR007110 | 401 | 488 | PS50835 | Immunoglobulin-like | |
IPR007110 | 493 | 581 | PS50835 | Immunoglobulin-like | |
IPR007110 | 585 | 667 | PS50835 | Immunoglobulin-like | |
IPR003961 | 677 | 769 | PS50853 | Fibronectin | |
IPR003961 | 776 | 869 | PS50853 | Fibronectin | |
IPR003961 | 874 | 976 | PS50853 | Fibronectin | |
IPR003961 | 981 | 1074 | PS50853 | Fibronectin |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1090 | QGWFIGLMCAIALLVLILLIVCF | 1112 | PRIMARY | 23 |
---|
![]() |
Primer_f | TGCACCCCAATACAGAACATC |
---|---|
Primer_r | TGAGAGCCCTAAGTGAAATTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGCACCCCAATACAGAACATC |
Primer_r | TGAGAGCCCTAAGTGAAATTC |
PCR product length | 162 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |