Order Kazusa clone(s) from : ![]() |
Product ID | ORK07039 |
---|---|
Accession No | AB023228 |
Description | spectrin repeat containing, nuclear envelope 2 |
Clone name | ff02850 |
Vector information | |
cDNA sequence | DNA sequence (11532 bp) Predicted protein sequence (3541 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1011
by Kazusa Mouse cDNA Project
|
Note | We replaced hj05612 and fj05552, former representative clones for KIAA1011 with ff02850. (2002/5/10,2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 906 bp |
---|---|
Genome contig ID | gi51511730f_63499253 |
PolyA signal sequence (ATTAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (263652 - 263701) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | f | 63599253 | 63762903 | 67 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002017 | 1578 | 1687 | PF00435 | Spectrin repeat |
IPR002017 | 1688 | 1801 | PF00435 | Spectrin repeat | |
IPR002017 | 1804 | 1908 | PF00435 | Spectrin repeat | |
IPR002017 | 2551 | 2653 | PF00435 | Spectrin repeat | |
IPR002017 | 2656 | 2767 | PF00435 | Spectrin repeat | |
IPR002017 | 2770 | 2876 | PF00435 | Spectrin repeat | |
IPR002017 | 2879 | 2983 | PF00435 | Spectrin repeat | |
IPR002017 | 3208 | 3315 | PF00435 | Spectrin repeat | |
IPR002017 | 3318 | 3426 | PF00435 | Spectrin repeat | |
HMMSmart | IPR002017 | 320 | 415 | SM00150 | Spectrin repeat |
IPR002017 | 1475 | 1574 | SM00150 | Spectrin repeat | |
IPR002017 | 1581 | 1686 | SM00150 | Spectrin repeat | |
IPR002017 | 1696 | 1800 | SM00150 | Spectrin repeat | |
IPR002017 | 1807 | 1907 | SM00150 | Spectrin repeat | |
IPR002017 | 1913 | 2015 | SM00150 | Spectrin repeat | |
IPR002017 | 2230 | 2330 | SM00150 | Spectrin repeat | |
IPR002017 | 2447 | 2547 | SM00150 | Spectrin repeat | |
IPR002017 | 2554 | 2652 | SM00150 | Spectrin repeat | |
IPR002017 | 2659 | 2766 | SM00150 | Spectrin repeat | |
IPR002017 | 2773 | 2875 | SM00150 | Spectrin repeat | |
IPR002017 | 2882 | 2982 | SM00150 | Spectrin repeat | |
IPR002017 | 3211 | 3314 | SM00150 | Spectrin repeat | |
IPR002017 | 3321 | 3425 | SM00150 | Spectrin repeat | |
ProfileScan | IPR012315 | 3482 | 3541 | PS51049 | Klarsicht/ANC-1/syne-1 homology |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 3491 | AALPLQLLLLLLLLLACLLPSS | 3512 | PRIMARY | 22 |
---|
![]() |
Primer_f | ATGTTCTGTTCAGTACCTAGC |
---|---|
Primer_r | ACATTAGTCAAAAGCTCCAGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ATGTTCTGTTCAGTACCTAGC |
Primer_r | ACATTAGTCAAAAGCTCCAGC |
PCR product length | 179 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |