KIAA1011

Product ID	ORK07039
Accession No	AB023228
Description	spectrin repeat containing, nuclear envelope 2
Clone name	ff02850
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (11532 bp) Predicted protein sequence (3541 aa)
Source	Human fetal brain
Rouge ID	mKIAA1011 by Kazusa Mouse cDNA Project
Note	We replaced hj05612 and fj05552, former representative clones for KIAA1011 with ff02850. (2002/5/10,2005/08/06)

Length: 11532 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	906 bp
Genome contig ID	gi51511730f_63499253
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- TCAGATGTTTCTCATTAAAAAACAAAATTAGCCAG
Flanking genome sequence (263652 - 263701)	----+--------+--------+--------+--------+----* ACTTCTGTTGTACTGAATTCTGTAACAAAGCAGTTCAGTGGTATGCTTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	63599253	63762903	67	100.0	Perfect prediction

Length: 3541 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_878918	100.0	spectrin repeat...	Homo sapiens
EAW80843	99.3	spectrin repeat...	Homo sapiens
Q8WXH0	99.3	Nesprin-2; Nucl...	Homo sapiens
EAW80842	99.3	spectrin repeat...	Homo sapiens
AAL33548	99.3	NUANCE [Homo sa...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018339	2.8e-134	44.5	KIAA0796
AB033088	1.8e-16	29.6	KIAA1262
AB007934	1.3e-14	19.7	KIAA0465
AB018271	2e-13	19.7	KIAA0728
AB008567	0.00016	20.3	KIAA0302

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002017	1578	1687	PF00435	Spectrin repeat
	IPR002017	1688	1801	PF00435	Spectrin repeat
	IPR002017	1804	1908	PF00435	Spectrin repeat
	IPR002017	2551	2653	PF00435	Spectrin repeat
	IPR002017	2656	2767	PF00435	Spectrin repeat
	IPR002017	2770	2876	PF00435	Spectrin repeat
	IPR002017	2879	2983	PF00435	Spectrin repeat
	IPR002017	3208	3315	PF00435	Spectrin repeat
	IPR002017	3318	3426	PF00435	Spectrin repeat
HMMSmart	IPR002017	320	415	SM00150	Spectrin repeat
	IPR002017	1475	1574	SM00150	Spectrin repeat
	IPR002017	1581	1686	SM00150	Spectrin repeat
	IPR002017	1696	1800	SM00150	Spectrin repeat
	IPR002017	1807	1907	SM00150	Spectrin repeat
	IPR002017	1913	2015	SM00150	Spectrin repeat
	IPR002017	2230	2330	SM00150	Spectrin repeat
	IPR002017	2447	2547	SM00150	Spectrin repeat
	IPR002017	2554	2652	SM00150	Spectrin repeat
	IPR002017	2659	2766	SM00150	Spectrin repeat
	IPR002017	2773	2875	SM00150	Spectrin repeat
	IPR002017	2882	2982	SM00150	Spectrin repeat
	IPR002017	3211	3314	SM00150	Spectrin repeat
	IPR002017	3321	3425	SM00150	Spectrin repeat
ProfileScan	IPR012315	3482	3541	PS51049	Klarsicht/ANC-1/syne-1 homology

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	3491	AALPLQLLLLLLLLLACLLPSS	3512	PRIMARY	22

Primer_f	ATGTTCTGTTCAGTACCTAGC
Primer_r	ACATTAGTCAAAAGCTCCAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ATGTTCTGTTCAGTACCTAGC
Primer_r	ACATTAGTCAAAAGCTCCAGC
PCR product length	179 bp
PCR conditions	95 °C15 sec62 °C60 sec35 cycles