KIAA1302

Product ID	ORK06220
Accession No	AB037723
Description	teneurin transmembrane protein 4
Clone name	ff04539
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (10826 bp) Predicted protein sequence (2016 aa)
Source	Human fetal brain
Rouge ID	mKIAA1302 by Kazusa Mouse cDNA Project
Note	We replaced fg06864 and bf00104, former representative clones for KIAA1302 with ff04539. (2002/5/10,2005/08/06)

Length: 10826 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4775 bp
Genome contig ID	gi51511727r_77941977
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AGCCTTCGTTGACAAATAAAGACTATTTTGTGTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACAGGTGTCTGGTGGCCTTTGCTTGGAGATAAAGGCTTCCTCTTGCCTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	78041977	78175696	19	99.5	Perfect prediction

Length: 2016 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6N022	100.0	Teneurin-4; Sho...	Homo sapiens
XP_858706	98.5	similar to odd ...	Canis lupus fam...
XP_858664	98.5	similar to odd ...	Canis lupus fam...
XP_001494247	98.5	odz, odd Oz/ten...	Equus caballus
XP_218927	97.6	similar to odd ...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040888	0	70.2	KIAA1455
AB032953	0	66.5	KIAA1127
AB058677	2.5e-05	27.4	KIAA1781
AB058676	4.6e-05	29.4	KIAA1780
D63483	0.00028	30.9	KIAA0149

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013111	7	33	PF07974	EGF
	IPR001258	476	502	PF01436	NHL repeat
	IPR001258	594	619	PF01436	NHL repeat
	IPR001258	653	688	PF01436	NHL repeat
	IPR001258	714	741	PF01436	NHL repeat
	IPR001258	783	810	PF01436	NHL repeat
	IPR006530	859	896	PF05593	YD repeat
	IPR006530	922	960	PF05593	YD repeat
	IPR006530	1464	1498	PF05593	YD repeat
	IPR006530	1518	1571	PF05593	YD repeat
HMMSmart	IPR006210	6	34	SM00181	EGF
HMMSmart	IPR006210	46	78	SM00181	EGF
HMMTigr	IPR006530	859	900	TIGR01643	YD repeat
	IPR006530	923	964	TIGR01643	YD repeat
	IPR006530	1134	1174	TIGR01643	YD repeat
	IPR006530	1443	1482	TIGR01643	YD repeat
	IPR006530	1518	1560	TIGR01643	YD repeat
ProfileScan	IPR000742	3	34	PS50026	EGF-like
ProfileScan	IPR000742	43	78	PS50026	EGF-like
ScanRegExp	IPR013032	22	33	PS00022	EGF-like region
	IPR013032	22	33	PS01186	EGF-like region
	IPR013032	66	77	PS00022	EGF-like region
	IPR013032	66	77	PS01186	EGF-like region

Primer_f	CATTGCTGAGGTGATAGAGAG
Primer_r	CCTTCCCACACTCTGATATTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-