KIAA1909

Product ID	ORK07571
Accession No	AB067496
Description	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B
Clone name	ff10210
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (11527 bp) Predicted protein sequence (1287 aa)
HaloTag ORF Clone	FHC07571
Flexi ORF Clone	FXC07571
Source	Human fetal brain
Note	We replaced fh11423, former representative clones for KIAA1909 with ff10210. (2005/08/06)

Length: 11527 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	7661 bp
Genome contig ID	gi51511721f_93373
PolyA signal sequence (None)	+--------+--------+----*----+---- AAAAAAAAAAAAGGGCGACCGCTCGCGATCTAGAA
Flanking genome sequence	None

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	193373	280063	22	99.2	Both No-hit

Length: 1287 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96PX9	0	100.0	Pleckstrin homo...	Homo sapiens
AAI56563	0	99.7	Pleckstrin homo...	synthetic construct
XP_526816	0	98.5	hypothetical pr...	Pan troglodytes
AAH08352	3.2e-134	100.0	PLEKHG4B protei...	Homo sapiens
EAW50980	7.9e-107	98.1	hCG2038550 [Hom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051542	5.8e-17	31.2	KIAA1755
AB002360	7.9e-13	26.9	KIAA0362
AB020668	4.3e-07	24.2	KIAA0861

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000219	825	991	PF00621	DH
HMMPfam	IPR001849	1019	1115	PF00169	Pleckstrin-like
HMMSmart	IPR000219	825	999	SM00325	DH
HMMSmart	IPR001849	1013	1122	SM00233	Pleckstrin-like
ProfileScan	IPR000219	821	1000	PS50010	DH
ProfileScan	IPR001849	1012	1120	PS50003	Pleckstrin-like

Primer_f	GTGAATTTGAAGGAACAGGGG
Primer_r	TTCTCTGTCATCCCGATCTCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-