KIAA0861

Product ID	ORK05947
Accession No	AB020668
Description	MCF.2 cell line derived transforming sequence-like 2
Clone name	hk06521
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4282 bp) Predicted protein sequence (982 aa)
Source	Human adult brain

Length: 4282 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1333 bp
Genome contig ID	gi89161205r_184278525
PolyA signal sequence (ATTAAA,-25)	+--------+--------+----*----+---- TTATTTGACTATTAAACACTCACTGGAAGTTCATG
Flanking genome sequence (360847 - 360798)	----+--------+--------+--------+--------+----* AATGGAGGTTCATGTTGCTCAGCCCATGCATACTCTCTATCTCTTTCACC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	184377653	184539371	28	98.4	Terminal No-hit

Length: 982 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAO19651	99.9	Rho family guan...	Homo sapiens
Q86YR7	99.8	Probable guanin...	Homo sapiens
NP_055893	99.7	Rho family guan...	Homo sapiens
XP_535818	81.6	similar to Rho ...	Canis lupus fam...
XP_001790475	79.7	similar to Rho ...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002360	2.3e-60	43.0	KIAA0362
AB067496	4e-10	24.2	KIAA1909
AB029035	4.4e-05	27.6	KIAA1112
AB046859	0.00028	23.7	KIAA1639

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000219	491	689	PF00621	DH
HMMPfam	IPR001849	709	822	PF00169	Pleckstrin-like
HMMSmart	IPR002017	191	296	SM00150	Spectrin repeat
	IPR000219	491	689	SM00325	DH
	IPR001849	709	824	SM00233	Pleckstrin-like
ProfileScan	IPR001251	1	61	PS50191	Cellular retinaldehyde-binding/triple function
	IPR000219	487	690	PS50010	DH
	IPR001849	702	822	PS50003	Pleckstrin-like

Primer_f	GACTTGAGAAATACATCCTGC
Primer_r	CAGTCTTCAAAGGTGTCCATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ACATGGAAAAGGAGAGCAGTG
Primer_r	CGTTTCCTCCTCATCGCGTTC
PCR product length	146 (0.5k) bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles