KIAA1020

Product ID	ORK00714
Accession No	AB028943
Description	hypermethylated in cancer 2
Clone name	fg00473s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6793 bp) Predicted protein sequence (638 aa)
HaloTag ORF Clone	FHC00714
Flexi ORF Clone	FXC00714
Source	Human fetal brain
Rouge ID	mKIAA1020 by Kazusa Mouse cDNA Project
Note	We replaced fg00473, former representative clones for KIAA1020 with fg00473s1. (2002/5/10)

Length: 6793 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4715 bp
Genome contig ID	gi89161203f_20001693
PolyA signal sequence (ATTAAA,-16)	+--------+--------+----*----+---- GTTATTTTATGATCTTTTCATTAAAAGCTTGATTG
Flanking genome sequence (134057 - 134106)	----+--------+--------+--------+--------+----* AAAACTCTGGTGTGGGACCTCCATATTCTGCTTTGGCTGTTCTCTCTAGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	f	20101693	20135748	3	99.0	Perfect prediction

Length: 638 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG09938	9.8e-211	100.0	hypermethylated...	synthetic construct
Q96JB3	2e-210	99.8	Hypermethylated...	Homo sapiens
XP_515003	2.3e-208	98.9	hypermethylated...	Pan troglodytes
AAK72951	3e-202	99.5	HIC-3 [Homo sap...	Homo sapiens
XP_001492794	4.6e-198	94.0	hypermethylated...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB095928	5.3e-10	36.8	KIAA2007
AB037852	1.3e-09	33.8	KIAA1431
AB075862	1.7e-09	33.6	KIAA1982
AB058732	1.8e-09	37.1	KIAA1829
AB075836	3.3e-09	31.8	KIAA1956

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	584	607	PD000003	Zinc finger
HMMPfam	IPR013069	59	166	PF00651	BTB/POZ
	IPR007087	528	550	PF00096	Zinc finger
	IPR007087	556	578	PF00096	Zinc finger
	IPR007087	584	606	PF00096	Zinc finger
	IPR007087	612	634	PF00096	Zinc finger
HMMSmart	IPR000210	69	166	SM00225	BTB/POZ-like
	IPR015880	465	487	SM00355	Zinc finger
	IPR015880	528	550	SM00355	Zinc finger
	IPR015880	556	578	SM00355	Zinc finger
	IPR015880	584	606	SM00355	Zinc finger
	IPR015880	612	634	SM00355	Zinc finger
ProfileScan	IPR000210	69	132	PS50097	BTB/POZ-like
	IPR007087	465	492	PS50157	Zinc finger
	IPR007087	528	555	PS50157	Zinc finger
	IPR007087	556	583	PS50157	Zinc finger
	IPR007087	584	611	PS50157	Zinc finger
	IPR007087	612	638	PS50157	Zinc finger
ScanRegExp	IPR007087	467	487	PS00028	Zinc finger
	IPR007087	530	550	PS00028	Zinc finger
	IPR007087	558	578	PS00028	Zinc finger
	IPR007087	586	606	PS00028	Zinc finger
	IPR007087	614	634	PS00028	Zinc finger

Primer_f	AGCACTTAAGCCACATGACAC
Primer_r	AGGCTCGATACAATACTAAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-