KIAA1783

Product ID	ORK05710
Accession No	AB058686
Description	Homo sapiens mRNA for KIAA1783 protein, partial cds.
Clone name	fg01285
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6004 bp) Predicted protein sequence (1560 aa)
Source	Human fetal brain
Rouge ID	mKIAA1783 by Kazusa Mouse cDNA Project

Length: 6004 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	241 bp
Genome contig ID	gi51511734f_71002896
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- AGATGCTTAATAAACAGCTCTTCACTTTCCTGGCT
Flanking genome sequence (125703 - 125752)	----+--------+--------+--------+--------+----* TCTGGTCTTGCTCCTTTGGTGTCTGGCTGGGGAGGGATGGGGCTGGGGCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	71102896	71128597	38	99.9	Perfect prediction

Length: 1560 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96JP2	100.0	Putative myosin...	Homo sapiens
EAW89288	99.9	hCG1987119, iso...	Homo sapiens
XP_001095714	90.7	similar to Myos...	Macaca mulatta
CAM21226	70.2	myosin XVB [Mus...	Mus musculus
EAW89286	99.8	hCG1987119, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018342	5.5e-07	33.1	KIAA0799

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001609	146	353	PF00063	Myosin head
	IPR000048	386	406	PF00612	IQ calmodulin-binding region
	IPR000857	561	673	PF00784	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
	IPR011511	1456	1511	PF07653	Variant SH3
HMMSmart	IPR001609	51	366	SM00242	Myosin head
	IPR000857	522	673	SM00139	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
	IPR001452	1455	1512	SM00326	Src homology-3
ProfileScan	IPR000048	385	414	PS50096	IQ calmodulin-binding region
	IPR000857	522	673	PS51016	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
	IPR001452	1452	1513	PS50002	Src homology-3

Primer_f	TGAGACTGAGGAAGGAAAGGG
Primer_r	ACACAAGAGCAGCATCCAGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGAGACTGAGGAAGGAAAGGG
Primer_r	ACACAAGAGCAGCATCCAGCC
PCR product length	176 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles