KIAA1078

Product ID	ORK04430
Accession No	AB029001
Description	calmodulin regulated spectrin-associated protein family, member 2
Clone name	fg04938
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6740 bp) Predicted protein sequence (1365 aa)
Source	Human fetal brain
Rouge ID	mKIAA1078 by Kazusa Mouse cDNA Project
Note	We replaced hj06941, former representative clones for KIAA1078 with fg04938. (2002/5/10)

Length: 6740 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2642 bp
Genome contig ID	gi89161185f_198943126
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TTTTTCCCCTTTCATTTGAATAAAAGCATGGCACC
Flanking genome sequence (153328 - 153377)	----+--------+--------+--------+--------+----* AAATGACTCCTTTTCTGTTTCTTGAATAAAATGTAGTTTTTGGTAAAATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	198996823	199096452	17	100.0	Perfect prediction

Length: 1365 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI17077	99.9	calmodulin regu...	Homo sapiens
Q08AD1	99.9	Calmodulin-regu...	Homo sapiens
XP_001144062	99.3	hypothetical pr...	Pan troglodytes
XP_001143995	99.3	hypothetical pr...	Pan troglodytes
EAW91321	99.1	calmodulin regu...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040976	2.2e-19	35.4	KIAA1543

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014797	1224	1353	PF08683	Protein of unknown function DUF1781

Primer_f	TATACAGGACCAAAGCTCTAC
Primer_r	TCTGAACTGGCATCCTGAATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-